Transcript: Mouse XM_006506467.3

PREDICTED: Mus musculus coiled-coil-helix-coiled-coil-helix domain containing 3 (Chchd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chchd3 (66075)
Length:
1583
CDS:
199..897

Additional Resources:

NCBI RefSeq record:
XM_006506467.3
NBCI Gene record:
Chchd3 (66075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240962 CCTCCAGTGTTACCGTCAGAA pLKO_005 783 CDS 100% 4.950 3.960 N Chchd3 n/a
2 TRCN0000240963 ATGGACTCAACTGAATCATAA pLKO_005 1021 3UTR 100% 13.200 9.240 N Chchd3 n/a
3 TRCN0000240964 CAAGTTCAAGCGGTATGAATA pLKO_005 729 CDS 100% 13.200 9.240 N Chchd3 n/a
4 TRCN0000190614 GCTGTCCTTCGGGAAAGAATA pLKO.1 511 CDS 100% 13.200 9.240 N Chchd3 n/a
5 TRCN0000240960 TCTGCTCTGGCTAGCCAATAC pLKO_005 826 CDS 100% 10.800 7.560 N Chchd3 n/a
6 TRCN0000240961 TGCTGGAGAAGGGAGGCTAAA pLKO_005 878 CDS 100% 10.800 7.560 N Chchd3 n/a
7 TRCN0000190651 GCCATGTTCTAGATCAGCGAT pLKO.1 1067 3UTR 100% 2.640 1.848 N Chchd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03484 pDONR223 100% 85.6% 88.3% None (many diffs) n/a
2 ccsbBroad304_03484 pLX_304 0% 85.6% 88.3% V5 (many diffs) n/a
3 TRCN0000479814 TGAGAATATTCACCACGAAGATTG pLX_317 53.2% 85.6% 88.3% V5 (many diffs) n/a
Download CSV