Construct: ORF TRCN0000479839
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000165.3_s317c1
- Derived from:
- ccsbBroadEn_07827
- DNA Barcode:
- TGAATTGGTCAAATGCGCGTAGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STK38L (23012)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479839
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23012 | STK38L | serine/threonine kinase 38 ... | NM_015000.4 | 99.9% | 100% | 993G>A |
2 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_006719058.4 | 99.9% | 100% | 993G>A |
3 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448894.1 | 99.9% | 100% | 993G>A |
4 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448895.1 | 99.9% | 100% | 993G>A |
5 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448896.1 | 99.9% | 100% | 993G>A |
6 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448897.1 | 99.9% | 100% | 993G>A |
7 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_005253342.4 | 91% | 91.1% | 182_183ins123;870G>A |
8 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448889.1 | 88.9% | 88.8% | 776_946del;1164G>A |
9 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448890.1 | 88.9% | 88.8% | 776_946del;1164G>A |
10 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448891.1 | 88.9% | 88.8% | 776_946del;1164G>A |
11 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448892.1 | 88.9% | 88.8% | 776_946del;1164G>A |
12 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_024448893.1 | 88.9% | 88.8% | 776_946del;1164G>A |
13 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_006719059.3 | 88.7% | 88.7% | 0_1ins156;837G>A |
14 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XM_011520613.2 | 79.8% | 79.9% | 0_1ins156;26_27ins123;714G>A |
15 | human | 23012 | STK38L | serine/threonine kinase 38 ... | XR_001748626.1 | 27.1% | (many diffs) | |
16 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | NM_172734.3 | 89.8% | 97.6% | (many diffs) |
17 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507027.2 | 88.4% | 96.1% | (many diffs) |
18 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507029.3 | 87.3% | 94.9% | (many diffs) |
19 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507031.2 | 78% | 85.3% | (many diffs) |
20 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | NM_001346666.1 | 66.6% | 72.6% | (many diffs) |
21 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_017321560.1 | 66.6% | 72.6% | (many diffs) |
22 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507032.2 | 65.6% | 71.5% | (many diffs) |
23 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XM_006507033.2 | 65.6% | 71.5% | (many diffs) |
24 | mouse | 232533 | Stk38l | serine/threonine kinase 38 ... | XR_001785124.1 | 18.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1458
- ORF length:
- 1392
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aatgacggca gggactacaa caacctttcc tatgagcaac catacccggg 121 aaagagtgac tgtagccaag ctcacattgg agaattttta tagcaaccta attttacagc 181 atgaagagag agaaaccagg cagaagaaat tagaagtggc catggaagaa gaaggattag 241 cagatgaaga gaaaaagtta cgtcgatcac aacacgctcg caaagaaaca gagttcttac 301 ggctcaaaag gaccagactt ggcttggatg actttgagtc tctgaaagtt ataggaagag 361 gagcttttgg agaggtgcgg ttggtccaga agaaagatac aggccatatc tatgcaatga 421 agatattgag aaagtctgat atgcttgaaa aagagcaggt ggcccatatc cgagcagaaa 481 gagatatttt ggtagaagca gatggtgcct gggtggtgaa gatgttttac agttttcagg 541 ataagaggaa tctttatcta atcatggaat ttctccctgg aggtgacatg atgacattgc 601 taatgaagaa agacaccttg acagaagagg aaacacagtt ctacatttca gagactgttc 661 tggcaataga tgcgatccac cagttgggtt tcatccatcg ggatattaag ccagacaacc 721 ttttattgga tgccaagggt catgtaaaat tatctgattt tggtttatgt acgggattaa 781 agaaagctca caggactgaa ttttatagaa atctcacaca caacccacca agtgacttct 841 catttcagaa catgaactca aagaggaaag cagaaacttg gaagaagaac aggagacaac 901 tggcatattc cacagttggg acaccagatt acattgctcc agaagtattc atgcagactg 961 gttacaacaa attgtgtgac tggtggtctt tgggagtgat tatgtatgaa atgctaatag 1021 gatatccacc tttctgctcT GAAACACCTC AAGAAACATA CAGAAAAGTG ATGAACTGGA 1081 AAGAAACTCT GGTATTTCCT CCAGAGGTAC CTATATCTGA GAAAGCCAAG GACTTAATTC 1141 TCAGATTTTG TATTGATTCT GAAAACAGAA TTGGAAATAG TGGAGTAGAA GAAATAAAAG 1201 GTCATCCCTT TTTTGAAGGT GTCGACTGGG AGCACATAAG GGAAAGGCCA GCAGCAATCC 1261 CTATAGAAAT CAAAAGCATT GATGATACTT CAAATTTTGA TGACTTCCCT GAATCTGATA 1321 TTTTACAACC AGTGCCAAAT ACCACAGAAC CGGACTACAA ATCCAAAGAC TGGGTTTTTC 1381 TCAATTATAC CTATAAAAGG TTTGAAGGGT TGACTCAACG TGGCTCTATC CCCACCTACA 1441 TGAAAGCTGG GAAGTTATGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1501 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1561 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATGAATTG GTCAAATGCG 1621 CGTAGGAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt