Transcript: Mouse NM_001346666.1

Mus musculus serine/threonine kinase 38 like (Stk38l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stk38l (232533)
Length:
4425
CDS:
284..1327

Additional Resources:

NCBI RefSeq record:
NM_001346666.1
NBCI Gene record:
Stk38l (232533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362190 ACAGAGTTCTTACGCCTTAAG pLKO_005 155 5UTR 100% 10.800 15.120 N Stk38l n/a
2 TRCN0000362115 CGATCGCAGCATGCTCGTAAA pLKO_005 131 5UTR 100% 10.800 15.120 N Stk38l n/a
3 TRCN0000022910 CCTATAGAAATCCGGAGTATA pLKO.1 1127 CDS 100% 13.200 10.560 N Stk38l n/a
4 TRCN0000022913 GAGCCCGACTACAAATCCAAA pLKO.1 1214 CDS 100% 4.950 3.960 N Stk38l n/a
5 TRCN0000362191 TCCGAGCAGAAAGGGACATTT pLKO_005 336 CDS 100% 13.200 9.240 N Stk38l n/a
6 TRCN0000362192 TTTGAGTCTCTGAAGGTTATA pLKO_005 200 5UTR 100% 13.200 9.240 N Stk38l n/a
7 TRCN0000022912 GCACATCTATGCCATGAAGAT pLKO.1 271 5UTR 100% 4.950 3.465 N Stk38l n/a
8 TRCN0000022911 CATCCGTTCTTTGAGGGTGTA pLKO.1 1070 CDS 100% 4.050 2.835 N Stk38l n/a
9 TRCN0000022909 GCTGATGAAGAAGGACACCTT pLKO.1 466 CDS 100% 2.640 1.848 N Stk38l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07827 pDONR223 100% 66.6% 72.6% None (many diffs) n/a
2 ccsbBroad304_07827 pLX_304 0% 66.6% 72.6% V5 (many diffs) n/a
3 TRCN0000479839 TGAATTGGTCAAATGCGCGTAGGA pLX_317 30.3% 66.6% 72.6% V5 (many diffs) n/a
4 ccsbBroadEn_15003 pDONR223 0% 66.6% 72.6% None (many diffs) n/a
5 ccsbBroad304_15003 pLX_304 0% 66.6% 72.6% V5 (many diffs) n/a
6 TRCN0000473060 TCACTATTTTAATAAGACACTAGC pLX_317 29.7% 66.6% 72.6% V5 (many diffs) n/a
7 TRCN0000487750 GACAGTGGCTCCGCGAAATTAGCA pLX_317 15% 66.6% 72.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489326 TCGGATCCGAACATAAATCACACT pLX_317 27.8% 66.4% 72.4% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489899 ACCACTCCCGTCCGCAATCTAGCC pLX_317 29.9% 66.4% 72.6% V5 (many diffs) n/a
Download CSV