Transcript: Human XM_006719058.4

PREDICTED: Homo sapiens serine/threonine kinase 38 like (STK38L), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK38L (23012)
Length:
4627
CDS:
181..1575

Additional Resources:

NCBI RefSeq record:
XM_006719058.4
NBCI Gene record:
STK38L (23012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719058.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196612 GTTTCATCCATCGGGATATTA pLKO.1 803 CDS 100% 15.000 21.000 N STK38L n/a
2 TRCN0000320877 ACTGCCTACATGCGTATTAAG pLKO_005 1847 3UTR 100% 13.200 18.480 N STK38L n/a
3 TRCN0000195441 CCACAGAACCGGACTACAAAT pLKO.1 1457 CDS 100% 13.200 18.480 N STK38L n/a
4 TRCN0000355732 GGCTTGCTTGGCGTAGATAAC pLKO_005 1628 3UTR 100% 10.800 15.120 N STK38L n/a
5 TRCN0000196904 GCAGACTGGTTACAACAAATT pLKO.1 1068 CDS 100% 13.200 10.560 N STK38L n/a
6 TRCN0000320812 TCCGAGCAGAAAGAGATATTT pLKO_005 584 CDS 100% 15.000 10.500 N STK38L n/a
7 TRCN0000320888 GGTTTCATCCATCGGGATATT pLKO_005 802 CDS 100% 13.200 9.240 N STK38L n/a
8 TRCN0000350288 GTGTCGACTGGGAGCACATAA pLKO_005 1334 CDS 100% 13.200 9.240 N STK38L n/a
9 TRCN0000355733 TTGGTTTATGTACGGGATTAA pLKO_005 875 CDS 100% 13.200 9.240 N STK38L n/a
10 TRCN0000002055 CCAGCAGCAATCCCTATAGAA pLKO.1 1363 CDS 100% 5.625 3.938 N STK38L n/a
11 TRCN0000002056 TGGGAGTGATTATGTATGAAA pLKO.1 1106 CDS 100% 5.625 3.938 N STK38L n/a
12 TRCN0000002057 CCCTGGAGTTAATAGAGTGAT pLKO.1 3793 3UTR 100% 4.950 3.465 N STK38L n/a
13 TRCN0000002053 GAAGAAGGATTAGCAGATGAA pLKO.1 343 CDS 100% 4.950 3.465 N STK38L n/a
14 TRCN0000002054 AGAAGAAAGATACAGGCCATA pLKO.1 503 CDS 100% 4.050 2.430 N STK38L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719058.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07827 pDONR223 100% 99.9% 100% None 993G>A n/a
2 ccsbBroad304_07827 pLX_304 0% 99.9% 100% V5 993G>A n/a
3 TRCN0000479839 TGAATTGGTCAAATGCGCGTAGGA pLX_317 30.3% 99.9% 100% V5 993G>A n/a
4 ccsbBroadEn_15003 pDONR223 0% 99.9% 100% None 993G>A n/a
5 ccsbBroad304_15003 pLX_304 0% 99.9% 100% V5 993G>A n/a
6 TRCN0000473060 TCACTATTTTAATAAGACACTAGC pLX_317 29.7% 99.9% 100% V5 993G>A n/a
7 TRCN0000487750 GACAGTGGCTCCGCGAAATTAGCA pLX_317 15% 99.9% 100% V5 (not translated due to prior stop codon) 993G>A n/a
8 TRCN0000489899 ACCACTCCCGTCCGCAATCTAGCC pLX_317 29.9% 99.7% 100% V5 993G>A;1391_1392delTA n/a
9 TRCN0000489326 TCGGATCCGAACATAAATCACACT pLX_317 27.8% 99.7% 99.7% V5 (not translated due to prior stop codon) 993G>A;1392_1393insTTG n/a
Download CSV