Construct: ORF TRCN0000479847
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006451.1_s317c1
- Derived from:
- ccsbBroadEn_02317
- DNA Barcode:
- TTTAAATTCGCCGCAACCCGCGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGK2 (10110)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479847
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_001199264.1 | 100% | 100% | |
2 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_170693.3 | 100% | 100% | |
3 | human | 10110 | SGK2 | serum/glucocorticoid regula... | NM_016276.3 | 85.9% | 85.9% | 1_180del |
4 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_013731.3 | 89% | 94% | (many diffs) |
5 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_006499658.3 | 89% | 94% | (many diffs) |
6 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_001291152.1 | 88.7% | 93.7% | (many diffs) |
7 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | NM_001291154.1 | 82.2% | 86.6% | (many diffs) |
8 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_011239580.2 | 82.2% | 86.6% | (many diffs) |
9 | mouse | 27219 | Sgk2 | serum/glucocorticoid regula... | XM_006499660.3 | 71.7% | 71.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1167
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ctctagccca gctgggaccc caagtccaca gccctccagg gccaatggga 121 acatcaacct ggggccttca gccaacccaa atgcccagcc cacggacttc gacttcctca 181 aagtcatcgg caaagggaac tacgggaagg tcctactggc caagcgcaag tctgatgggg 241 cgttctatgc agtgaaggta ctacagaaaa agtccatctt aaagaagaaa gagcagagcc 301 acatcatggc agagcgcagt gtgcttctga agaacgtgcg gcaccccttc ctcgtgggcc 361 tgcgctactc cttccagaca cctgagaagc tctacttcgt gctcgactat gtcaacgggg 421 gagagctctt cttccacctg cagcgggagc gccggttcct ggagccccgg gccaggttct 481 acgctgctga ggtggccagc gccattggct acctgcactc cctcaacatc atttacaggg 541 atctgaaacc agagaacatt ctcttggact gccagggaca cgtggtgctg acggattttg 601 gcctctgcaa ggaaggtgta gagcctgaag acaccacatc cacattctgt ggtacccctg 661 agtacttggc acctgaagtg cttcggaaag agccttatga tcgagcagtg gactggtggt 721 gcttgggggc agtcctctac gagatgctcc atggcctgcc gcccttctac agccaagatg 781 tatcccagat gtatgagaac attctgcacc agccgctaca gaTCCCCGGA GGCCGGACAG 841 TGGCCGCCTG TGACCTCCTG CAAAGCCTTC TCCACAAGGA CCAGAGGCAG CGGCTGGGCT 901 CCAAAGCAGA CTTTCTTGAG ATTAAGAACC ATGTATTCTT CAGCCCCATA AACTGGGATG 961 ACCTGTACCA CAAGAGGCTA ACTCCACCCT TCAACCCAAA TGTGACAGGA CCTGCTGACT 1021 TGAAGCATTT TGACCCAGAG TTCACCCAGG AAGCTGTGTC CAAGTCCATT GGCTGTACCC 1081 CTGACACTGT GGCCAGCAGC TCTGGGGCCT CAAGTGCATT CCTGGGATTT TCTTATGCGC 1141 CAGAGGATGA TGACATCTTG GATTGCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1201 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1261 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTTAAATT 1321 CGCCGCAACC CGCGATACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1381 aagatt