Transcript: Mouse XM_011239580.2

PREDICTED: Mus musculus serum/glucocorticoid regulated kinase 2 (Sgk2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgk2 (27219)
Length:
2638
CDS:
557..1573

Additional Resources:

NCBI RefSeq record:
XM_011239580.2
NBCI Gene record:
Sgk2 (27219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022880 GCTCCAGAAGTGCTTCGTAAA pLKO.1 1073 CDS 100% 10.800 15.120 N Sgk2 n/a
2 TRCN0000361617 ATGTTCTTCAGTCCCATAAAC pLKO_005 1337 CDS 100% 13.200 9.240 N Sgk2 n/a
3 TRCN0000361691 TCTACTTTGTGCTTGACTATG pLKO_005 882 CDS 100% 10.800 7.560 N Sgk2 n/a
4 TRCN0000022879 CCTGCTGACTTGAAACACTTT pLKO.1 1415 CDS 100% 4.950 3.465 N Sgk2 n/a
5 TRCN0000022883 CCTTCACTCTCTCAACATCAT pLKO.1 1003 CDS 100% 4.950 3.465 N Sgk2 n/a
6 TRCN0000022881 CTCTACTTTGTGCTTGACTAT pLKO.1 881 CDS 100% 4.950 3.465 N Sgk2 n/a
7 TRCN0000022882 GCACAGGATGATGATGACATT pLKO.1 1541 CDS 100% 4.950 3.465 N Sgk2 n/a
8 TRCN0000002110 ACTCCACCCTTCAACCCAAAT pLKO.1 1385 CDS 100% 10.800 7.560 N SGK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02317 pDONR223 100% 82.2% 86.6% None (many diffs) n/a
2 ccsbBroad304_02317 pLX_304 0% 82.2% 86.6% V5 (many diffs) n/a
3 TRCN0000479847 TTTAAATTCGCCGCAACCCGCGAT pLX_317 31.6% 82.2% 86.6% V5 (many diffs) n/a
4 TRCN0000488680 AAACATTCTTGGGAGTCATGCGTT pLX_317 27.6% 82.2% 86.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487970 ATTTCGTGAGGGATAAGGCAAAAA pLX_317 27.6% 82.2% 86.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000472505 CCCGGTATCGCAATGGCCGGAACG pLX_317 37.5% 81.9% 37.1% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14954 pDONR223 100% 81.9% 37.1% None (many diffs) n/a
8 ccsbBroad304_14954 pLX_304 0% 81.9% 37.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000491343 AACTGCCGTTTTCCGAAGGAGCAC pLX_317 27.5% 81.9% 86.4% V5 (many diffs) n/a
Download CSV