Transcript: Human NM_001199264.1

Homo sapiens serum/glucocorticoid regulated kinase 2 (SGK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-30
Taxon:
Homo sapiens (human)
Gene:
SGK2 (10110)
Length:
1942
CDS:
196..1299

Additional Resources:

NCBI RefSeq record:
NM_001199264.1
NBCI Gene record:
SGK2 (10110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149504 AGAGCCTTATGATCGAGCAG pXPR_003 TGG 640 58% 10 0.5958 SGK2 SGK2 76208
2 BRDN0001147898 TGGGGCGTTCTATGCAGTGA pXPR_003 AGG 187 17% 5 0.4929 SGK2 SGK2 76209
3 BRDN0001148976 TTGAGGAAGTCGAAGTCCGT pXPR_003 GGG 99 9% 4 0.2062 SGK2 SGK2 76207
4 BRDN0001145816 CCGTCATTCTCAGGGACACG pXPR_003 TGG 514 47% 9 -0.2660 SGK2 SGK2 76206
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272923 TCTACTTCGTGCTCGACTATG pLKO_005 521 CDS 100% 10.800 15.120 N SGK2 n/a
2 TRCN0000196887 GTTCTGACACTAAGACATTAG pLKO.1 1760 3UTR 100% 10.800 8.640 N SGK2 n/a
3 TRCN0000199990 GCACCTGAAGTGCTTCGGAAA pLKO.1 799 CDS 100% 4.050 3.240 N SGK2 n/a
4 TRCN0000195097 CAACGAGAAGCAGGTTTATTT pLKO.1 1394 3UTR 100% 15.000 10.500 N SGK2 n/a
5 TRCN0000272924 CAACGAGAAGCAGGTTTATTT pLKO_005 1394 3UTR 100% 15.000 10.500 N SGK2 n/a
6 TRCN0000002113 GCTGGGAGATGTGGCTTATTT pLKO.1 1706 3UTR 100% 15.000 10.500 N SGK2 n/a
7 TRCN0000002112 GCACTCCCTCAACATCATTTA pLKO.1 645 CDS 100% 13.200 9.240 N SGK2 n/a
8 TRCN0000272861 GCACTCCCTCAACATCATTTA pLKO_005 645 CDS 100% 13.200 9.240 N SGK2 n/a
9 TRCN0000272862 ACACGTGGTGCTGACGGATTT pLKO_005 708 CDS 100% 10.800 7.560 N SGK2 n/a
10 TRCN0000002110 ACTCCACCCTTCAACCCAAAT pLKO.1 1111 CDS 100% 10.800 7.560 N SGK2 n/a
11 TRCN0000002111 TGAAGACACCACATCCACATT pLKO.1 756 CDS 100% 4.950 3.465 N SGK2 n/a
12 TRCN0000272863 TGAAGACACCACATCCACATT pLKO_005 756 CDS 100% 4.950 3.465 N SGK2 n/a
13 TRCN0000199849 CCTGAGTACTTGGCACCTGAA pLKO.1 787 CDS 100% 4.050 2.835 N SGK2 n/a
14 TRCN0000010682 CTCAAGTGCATTCCTGGGATT pLKO.1 1239 CDS 100% 4.050 2.835 N SGK2 n/a
15 TRCN0000196282 GATGATGACATCTTGGATTGC pLKO.1 1276 CDS 100% 4.050 2.835 N SGK2 n/a
16 TRCN0000199516 GCCCACGGACTTCGACTTCCT pLKO.1 288 CDS 100% 0.000 0.000 N SGK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02317 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02317 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479847 TTTAAATTCGCCGCAACCCGCGAT pLX_317 31.6% 100% 100% V5 n/a
4 TRCN0000488680 AAACATTCTTGGGAGTCATGCGTT pLX_317 27.6% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000487970 ATTTCGTGAGGGATAAGGCAAAAA pLX_317 27.6% 100% 100% V5 (not translated due to prior stop codon) n/a
6 TRCN0000491343 AACTGCCGTTTTCCGAAGGAGCAC pLX_317 27.5% 99.9% 99.7% V5 1101_1102insG n/a
7 TRCN0000472505 CCCGGTATCGCAATGGCCGGAACG pLX_317 37.5% 99.6% 35.2% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_14954 pDONR223 100% 99.5% 35.2% None (many diffs) n/a
9 ccsbBroad304_14954 pLX_304 0% 99.5% 35.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV