Construct: ORF TRCN0000479873
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005624.1_s317c1
- Derived from:
- ccsbBroadEn_15818
- DNA Barcode:
- TTAGTCTAGGTCCTCCACTGGCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CELA2B (51032)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479873
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51032 | CELA2B | chymotrypsin like elastase 2B | NM_015849.3 | 99.7% | 99.2% | 530A>G;623T>C |
| 2 | human | 63036 | CELA2A | chymotrypsin like elastase 2A | NM_033440.3 | 93% | 88.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 873
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat taggaccctg ctgctgtcca ctttggtggc tggagccctc agttgtgggg 121 tctccactta cgcgcctgat atgtctagga tgcttggagg tgaagaagcg aggcccaaca 181 gctggccctg gcaggtctcc ctgcagtaca gctccaatgg ccagtggtac cacacctgcg 241 gagggtccct gatagccaac agctgggtcc tgacggctgc ccactgcatc agctcctccg 301 ggatctaccg cgtgatgctg ggccagcata acctctacgt tgcagagtcc ggctcgctgg 361 ccgtcagtgt ctctaagatt gtggtgcaca aggactggaa ctccgaccag gtctccaaag 421 ggaacgacat tgccctgctc aaactggcta accccgtctc cctcaccgac aagatccagc 481 tggcctgcct ccctcctgcc ggcaccattc tacccaacaa ctacccctgc TACGTCACGG 541 GCTGGGGAAG GCTGCAGACC AACGGGGCTC TCCCTGATGA CCTGAAGCAG GGCCGGTTGC 601 TGGTTGTGGA CTATGCCACC TGCTCCAGCT CTGGCTGGTG GGGCAGCACC GTGAAGACGA 661 ATATGATCTG TGCTGGGGGT GATGGCGCGA TATGCACCTG CAACGGAGAC TCCGGTGGGC 721 CGCTGAACTG TCAGGCATCT GACGGCCGGT GGGAGGTGCA TGGCATCGGC AGCCTCACGT 781 CGGTCCTTGG TTGCAACTAC TACTACAAGC CCTCCATCTT CACGCGGGTC TCCAACTACA 841 ACGACTGGAT CAATTCGGTG ATTGCAAATA ACTACCCAAC TTTCTTGTAC AAAGTGGTTG 901 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 961 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 1021 AGTCTAGGTC CTCCACTGGC ATACGCGTTA AGTCgacaat caacctctgg attacaaaat 1081 ttgtgaaaga tt