Construct: ORF TRCN0000479917
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010311.1_s317c1
- Derived from:
- ccsbBroadEn_13929
- DNA Barcode:
- TCGAAGCGGGCTAATATTTGGCAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PRKACA (5566)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479917
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_002730.4 | 99.9% | 1.7% | 8_9insC |
| 2 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_207518.3 | 96.6% | .5% | (many diffs) |
| 3 | human | 5568 | PRKACG | protein kinase cAMP-activat... | NM_002732.3 | 85.3% | 1.4% | (many diffs) |
| 4 | human | 5566 | PRKACA | protein kinase cAMP-activat... | XM_017026948.1 | 84.2% | 2% | 8_9insC;760_761ins165 |
| 5 | human | 5566 | PRKACA | protein kinase cAMP-activat... | NM_001304349.1 | 81.6% | 1.1% | (many diffs) |
| 6 | mouse | 18747 | Prkaca | protein kinase, cAMP depend... | NM_008854.5 | 91.1% | 1.7% | (many diffs) |
| 7 | mouse | 18747 | Prkaca | protein kinase, cAMP depend... | NM_001277898.1 | 88.3% | 2.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 153
- ORF length:
- 84
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggcaaccgc cgccgccgcc aagaagggca gcgagcagga gagcgtgaaa 121 gaattcttag ccaaagccaa agaagatttt cttaaaaaat gggaaagtcc cgctcagaac 181 acagcccact tggatcagtt tgaacgaatc aagaccctcg gcacgggctc cttcgggcgg 241 gtgatgctgg tgaaacacaa ggagaccggg aaccactatg ccatgaagat cctcgacaaa 301 cagaaggtgg tgaaactgaa acagatcgaa cacaccctga atgaaaagcg catcctgcaa 361 gctgtcaact ttccgttcct cgtcaaactc gagttctcct tcaaggacaa ctcaaactta 421 tacatggtca tggagtacgt gcccggcggg gagatgttct cacacctacg gcggatcgga 481 aggttcagtg agccccatgc ccgtttctac gcggcccaga tcgtcctgac ctttgagtat 541 ctgcactcgc tggatctcat ctacagggac ctgaagccgg agaatctgct cattgaccag 601 cagggctaca ttcaggtgac agacttcggt ttcgccaagc gcgtgaaggg ccgcacttgg 661 accttgtgcg gcacccctga gtacctggcc cctgagatta tcctgagcaa aggctacaac 721 aaggccgtgg actggtgggc cctgggggtt cttatctatg aaatggccgc tggctacccg 781 cccttcttcg cagaccagcc caTCCAGATC TATGAGAAGA TCGTCTCTGG GAAGGTGCGC 841 TTCCCTTCCC ACTTCAGCTC TGACTTGAAG GACCTGCTGC GGAACCTCCT GCAGGTAGAT 901 CTCACCAAGC GCTTTGGGAA CCTCAAGAAT GGGGTCAACG ATATCAAGAA CCACAAGTGG 961 TTTGCCACAA CTGACTGGAT TGCCATCTAC CAGAGGAAGG TGGAAGCTCC CTTCATACCA 1021 AAGTTTAAAG GCCCTGGGGA TACGAGTAAC TTTGACGACT ATGAGGAAGA AGAAATCCGG 1081 GTCTCCATCA ATGAGAAGTG TGGCAAGGAG TTTTCTGAGT TTTTGCCAAC TTTCTTGTAC 1141 AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG 1201 TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA 1261 AAGGACGATC GAAGCGGGCT AATATTTGGC ATACGCGTTA AGTCgacaat caacctctgg 1321 attacaaaat ttgtgaaaga tt