Transcript: Human NM_207518.3

Homo sapiens protein kinase cAMP-activated catalytic subunit alpha (PRKACA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
PRKACA (5566)
Length:
2492
CDS:
37..1068

Additional Resources:

NCBI RefSeq record:
NM_207518.3
NBCI Gene record:
PRKACA (5566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207518.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356093 CCCACTTGCTAAGGGCAAATG pLKO_005 1488 3UTR 100% 10.800 15.120 N PRKACA n/a
2 TRCN0000001373 GATCGAACACACCCTGAATGA pLKO.1 267 CDS 100% 4.950 6.930 N PRKACA n/a
3 TRCN0000196512 GATCAGTTTGAACGAATCAAG pLKO.1 136 CDS 100% 4.950 3.960 N PRKACA n/a
4 TRCN0000010620 CTCAAACTTATACATGGTCAT pLKO.1 354 CDS 100% 4.050 3.240 N PRKACA n/a
5 TRCN0000194783 CAACCTTCCTTTCGGAGTAAT pLKO.1 1519 3UTR 100% 13.200 9.240 N PRKACA n/a
6 TRCN0000233528 CAACCTTCCTTTCGGAGTAAT pLKO_005 1519 3UTR 100% 13.200 9.240 N PRKACA n/a
7 TRCN0000194973 CAAGGACAACTCAAACTTATA pLKO.1 345 CDS 100% 13.200 9.240 N PRKACA n/a
8 TRCN0000233527 TCAAGGACAACTCAAACTTAT pLKO_005 344 CDS 100% 13.200 9.240 N PRKACA n/a
9 TRCN0000257349 AGATCGAACACACCCTGAATG pLKO_005 266 CDS 100% 10.800 7.560 N PRKACA n/a
10 TRCN0000233525 CAGCCCACTTGGATCAGTTTG pLKO_005 125 CDS 100% 10.800 7.560 N PRKACA n/a
11 TRCN0000367487 GATAATCAGAGGGACAGAAAC pLKO_005 1228 3UTR 100% 10.800 7.560 N PRKACA n/a
12 TRCN0000233526 TCCTGCAAGCTGTCAACTTTC pLKO_005 296 CDS 100% 10.800 7.560 N PRKACA n/a
13 TRCN0000367426 TTGACCAGCAGGGCTACATTC pLKO_005 536 CDS 100% 10.800 7.560 N PRKACA n/a
14 TRCN0000356094 TAGATCTCACCAAGCGCTTTG pLKO_005 839 CDS 100% 6.000 4.200 N PRKACA n/a
15 TRCN0000001372 GAAATCCGGGTCTCCATCAAT pLKO.1 1015 CDS 100% 5.625 3.938 N PRKACA n/a
16 TRCN0000012461 CCACTTCAGCTCTGACTTGAA pLKO.1 792 CDS 100% 4.950 3.465 N Prkaca n/a
17 TRCN0000344983 CCACTTCAGCTCTGACTTGAA pLKO_005 792 CDS 100% 4.950 3.465 N Prkaca n/a
18 TRCN0000001371 AGGTGGTGAAACTGAAACAGA pLKO.1 248 CDS 100% 3.000 2.100 N PRKACA n/a
19 TRCN0000001370 CAGGAAGCCCAGATAATCAGA pLKO.1 1217 3UTR 100% 3.000 2.100 N PRKACA n/a
20 TRCN0000194744 CCAGAGTTCCTTGCATCTAAT pLKO.1 1161 3UTR 100% 13.200 7.920 N PRKACA n/a
21 TRCN0000195044 CGAGTAACTTTGACGACTATG pLKO.1 986 CDS 100% 10.800 6.480 N PRKACA n/a
22 TRCN0000195421 CCTGAGCAAAGGCTACAACAA pLKO.1 645 CDS 100% 4.950 2.475 Y PRKACA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207518.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14780 pDONR223 100% 96.5% 95.4% None (many diffs) n/a
2 ccsbBroad304_14780 pLX_304 0% 96.5% 95.4% V5 (many diffs) n/a
3 TRCN0000469004 AGCTCTTGCTTGTTTAGCGGTACG pLX_317 32.5% 96.5% 95.4% V5 (many diffs) n/a
4 TRCN0000488898 CAAAACAACTTTGGAACTACCTTC pLX_317 24.2% 96.8% 96% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13929 pDONR223 100% 96.6% .5% None (many diffs) n/a
6 ccsbBroad304_13929 pLX_304 0% 96.6% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000479917 TCGAAGCGGGCTAATATTTGGCAT pLX_317 30.7% 96.6% .5% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000487900 CGAACGAGACCGACATCTCTTTTT pLX_317 17.7% 83% 80.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_06772 pDONR223 100% 82.9% 80.6% None (many diffs) n/a
10 ccsbBroad304_06772 pLX_304 52.2% 82.9% 80.6% V5 (many diffs) n/a
11 TRCN0000467017 AACAATATACGTGGATATGACGCA pLX_317 28.7% 82.9% 80.6% V5 (many diffs) n/a
12 ccsbBroadEn_14782 pDONR223 0% 82.9% 80.6% None (many diffs) n/a
13 ccsbBroad304_14782 pLX_304 40% 82.9% 80.6% V5 (many diffs) n/a
14 TRCN0000492182 ATTGCTTGTGAATTATCGGAGCAA pLX_317 22.9% 82.9% 80.6% V5 (many diffs) n/a
15 ccsbBroadEn_06771 pDONR223 100% 74.9% 88.6% None (many diffs) n/a
16 ccsbBroad304_06771 pLX_304 63.7% 74.9% 88.6% V5 (many diffs) n/a
17 TRCN0000472524 AGTACGTGTTCTAGAGGGTTTGTA pLX_317 40% 74.9% 88.6% V5 (many diffs) n/a
18 ccsbBroadEn_14781 pDONR223 0% 74.9% 88.6% None (many diffs) n/a
19 ccsbBroad304_14781 pLX_304 18.9% 74.9% 88.6% V5 (many diffs) n/a
20 TRCN0000480324 TTTCTTACTCCGACTCGAACCGGA pLX_317 38.8% 74.9% 88.6% V5 (many diffs) n/a
21 ccsbBroadEn_01278 pDONR223 100% 53.4% 64.6% None (many diffs) n/a
22 ccsbBroad304_01278 pLX_304 86.8% 53.4% 64.6% V5 (many diffs) n/a
Download CSV