Transcript: Human XM_017026948.1

PREDICTED: Homo sapiens protein kinase cAMP-activated catalytic subunit alpha (PRKACA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKACA (5566)
Length:
2371
CDS:
57..947

Additional Resources:

NCBI RefSeq record:
XM_017026948.1
NBCI Gene record:
PRKACA (5566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356093 CCCACTTGCTAAGGGCAAATG pLKO_005 1367 3UTR 100% 10.800 15.120 N PRKACA n/a
2 TRCN0000001373 GATCGAACACACCCTGAATGA pLKO.1 311 CDS 100% 4.950 6.930 N PRKACA n/a
3 TRCN0000196512 GATCAGTTTGAACGAATCAAG pLKO.1 180 CDS 100% 4.950 3.960 N PRKACA n/a
4 TRCN0000010620 CTCAAACTTATACATGGTCAT pLKO.1 398 CDS 100% 4.050 3.240 N PRKACA n/a
5 TRCN0000194783 CAACCTTCCTTTCGGAGTAAT pLKO.1 1398 3UTR 100% 13.200 9.240 N PRKACA n/a
6 TRCN0000233528 CAACCTTCCTTTCGGAGTAAT pLKO_005 1398 3UTR 100% 13.200 9.240 N PRKACA n/a
7 TRCN0000194973 CAAGGACAACTCAAACTTATA pLKO.1 389 CDS 100% 13.200 9.240 N PRKACA n/a
8 TRCN0000233527 TCAAGGACAACTCAAACTTAT pLKO_005 388 CDS 100% 13.200 9.240 N PRKACA n/a
9 TRCN0000257349 AGATCGAACACACCCTGAATG pLKO_005 310 CDS 100% 10.800 7.560 N PRKACA n/a
10 TRCN0000233525 CAGCCCACTTGGATCAGTTTG pLKO_005 169 CDS 100% 10.800 7.560 N PRKACA n/a
11 TRCN0000367487 GATAATCAGAGGGACAGAAAC pLKO_005 1107 3UTR 100% 10.800 7.560 N PRKACA n/a
12 TRCN0000233526 TCCTGCAAGCTGTCAACTTTC pLKO_005 340 CDS 100% 10.800 7.560 N PRKACA n/a
13 TRCN0000367426 TTGACCAGCAGGGCTACATTC pLKO_005 580 CDS 100% 10.800 7.560 N PRKACA n/a
14 TRCN0000001372 GAAATCCGGGTCTCCATCAAT pLKO.1 894 CDS 100% 5.625 3.938 N PRKACA n/a
15 TRCN0000001371 AGGTGGTGAAACTGAAACAGA pLKO.1 292 CDS 100% 3.000 2.100 N PRKACA n/a
16 TRCN0000001370 CAGGAAGCCCAGATAATCAGA pLKO.1 1096 3UTR 100% 3.000 2.100 N PRKACA n/a
17 TRCN0000194744 CCAGAGTTCCTTGCATCTAAT pLKO.1 1040 3UTR 100% 13.200 7.920 N PRKACA n/a
18 TRCN0000195044 CGAGTAACTTTGACGACTATG pLKO.1 865 CDS 100% 10.800 6.480 N PRKACA n/a
19 TRCN0000195421 CCTGAGCAAAGGCTACAACAA pLKO.1 689 CDS 100% 4.950 2.475 Y PRKACA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14780 pDONR223 100% 84% 83.7% None 680T>N;682_683delCTinsNN;760_761ins165 n/a
2 ccsbBroad304_14780 pLX_304 0% 84% 83.7% V5 680T>N;682_683delCTinsNN;760_761ins165 n/a
3 TRCN0000469004 AGCTCTTGCTTGTTTAGCGGTACG pLX_317 32.5% 84% 83.7% V5 680T>N;682_683delCTinsNN;760_761ins165 n/a
4 TRCN0000488898 CAAAACAACTTTGGAACTACCTTC pLX_317 24.2% 84.3% 84.3% V5 (not translated due to prior stop codon) 760_761ins165 n/a
5 ccsbBroadEn_13929 pDONR223 100% 84.2% 2% None 8_9insC;760_761ins165 n/a
6 ccsbBroad304_13929 pLX_304 0% 84.2% 2% V5 (not translated due to prior stop codon) 8_9insC;760_761ins165 n/a
7 TRCN0000479917 TCGAAGCGGGCTAATATTTGGCAT pLX_317 30.7% 84.2% 2% V5 (not translated due to prior stop codon) 8_9insC;760_761ins165 n/a
8 TRCN0000487900 CGAACGAGACCGACATCTCTTTTT pLX_317 17.7% 72.7% 70% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_14782 pDONR223 0% 72.6% 70% None (many diffs) n/a
10 ccsbBroad304_14782 pLX_304 40% 72.6% 70% V5 (many diffs) n/a
11 TRCN0000492182 ATTGCTTGTGAATTATCGGAGCAA pLX_317 22.9% 72.6% 70% V5 (many diffs) n/a
12 ccsbBroadEn_06772 pDONR223 100% 72.5% 70% None (many diffs) n/a
13 ccsbBroad304_06772 pLX_304 52.2% 72.5% 70% V5 (many diffs) n/a
14 TRCN0000467017 AACAATATACGTGGATATGACGCA pLX_317 28.7% 72.5% 70% V5 (many diffs) n/a
Download CSV