Construct: ORF TRCN0000479922
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005419.2_s317c1
- Derived from:
- ccsbBroadEn_07593
- DNA Barcode:
- CGACATGGTAAGTCGCGGGATCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CORO2B (10391)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479922
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10391 | CORO2B | coronin 2B | NM_001190456.1 | 99.8% | 99.7% | 697C>G;762C>T |
2 | human | 10391 | CORO2B | coronin 2B | NM_001190457.1 | 99.8% | 99.7% | 697C>G;762C>T |
3 | human | 10391 | CORO2B | coronin 2B | NM_001324014.1 | 99.8% | 99.7% | 697C>G;762C>T |
4 | human | 10391 | CORO2B | coronin 2B | NM_001324015.1 | 99.8% | 99.7% | 697C>G;762C>T |
5 | human | 10391 | CORO2B | coronin 2B | NM_006091.5 | 98.8% | 98.7% | 1_15del;712C>G;777C>T |
6 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511094.3 | 91.2% | 97.8% | (many diffs) |
7 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511097.3 | 91.2% | 97.8% | (many diffs) |
8 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511098.3 | 91.2% | 97.8% | (many diffs) |
9 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511099.3 | 91.2% | 97.8% | (many diffs) |
10 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511100.2 | 91.2% | 97.8% | (many diffs) |
11 | mouse | 235431 | Coro2b | coronin, actin binding prot... | XM_006511095.2 | 90.6% | 97.2% | (many diffs) |
12 | mouse | 235431 | Coro2b | coronin, actin binding prot... | NM_175484.3 | 90.2% | 96.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1491
- ORF length:
- 1425
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ctggcgtccg caataccgta gctccaagtt ccggaatgtc tacgggaagg 121 tggccaaccg ggagcactgc ttcgatggga tccccatcac caagaatgtg cacgacaacc 181 acttctgtgc cgtcaacacc cgcttcctgg ccatcgtcac cgagagcgca gggggcggct 241 ccttcctcgt catccccctg gagcagacag gcaggattga acccaactac cccaaggtct 301 gcggccacca gggcaatgtg ctggatatca aatggaaccc cttcatcgac aacatcattg 361 cctcgtgctc ggaggacacg tcggtgcgga tctgggagat ccccgagggc gggctgaagc 421 ggaacatgac ggaggcgctc ctggagctgc acgggcacag ccggcgtgtg gggctggtcg 481 agtggcaccc caccaccaac aacatcctgt tcagcgctgg ctacgactac aaggtcctca 541 tctggaacct ggatgtgggt gagccggtga agatgattga ctgccacacg gatgtgatcc 601 tctgcatgtc cttcaacacg gacggcagcc tgctcaccac cacgtgcaag gacaagaagc 661 tgcgtgtgat tgagccccgc tctggccgtg ttctgcagga ggccaactgc aaaaaccaca 721 gagtgaaccg ggtggtgttc ctggggaaca tgaagcggct cgtcacgaca ggggtctcca 781 ggtggaacac aagacagatt gccctctggg accaggagga cctctctatg cccctgatcg 841 aagaggaaat tgatgggctc tctggcctcc tgttcccctt ctatgatgct gacacccaca 901 tgctctacct ggctggaaag ggtgatggaa acatccggta ctacgagatc agcactgaga 961 agccctacct gagttacctc atggagttcc gctccccagc cccgcagaaa ggcctagggg 1021 tcatgcccaa gcacgggctg gatgtgtcag cctgcgaggt gttccgcttc tacaagctgg 1081 tgactctcaa gggcctgatc gagcccatct ccatgatcgt gccccggagg tcagattccT 1141 ACCAGGAAGA CATTTACCCA ATGACACCAG GCACGGAGCC AGCACTGACC CCGGATGAAT 1201 GGCTGGGAGG CATCAACCGA GATCCCGTGC TGATGTCTTT GAAAGAAGGC TATAAGAAGT 1261 CCTCAAAAAT GGTATTTAAG GCTCCCATCA AAGAAAAGAA GAGTGTTGTG GTCAACGGAA 1321 TAGATTTATT AGAAAATGTC CCACCCAGGA CAGAGAATGA GCTCCTTCGA ATGTTCTTCC 1381 GGCAGCAGGA TGAGATTCGA CGGTTGAAAG AGGAGCTGGC CCAGAAGGAC ATCCGCATTC 1441 GGCAGCTCCA GCTGGAACTG AAAAACTTGC GCAACAGCCC CAAGAACTGT TACCCAACTT 1501 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1561 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1621 CTTGTGGAAA GGACGACGAC ATGGTAAGTC GCGGGATCGC ACGCGTTAAG TCgacaatca 1681 acctctggat tacaaaattt gtgaaagatt