Transcript: Mouse XM_006511100.2

PREDICTED: Mus musculus coronin, actin binding protein, 2B (Coro2b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Coro2b (235431)
Length:
3240
CDS:
23..1450

Additional Resources:

NCBI RefSeq record:
XM_006511100.2
NBCI Gene record:
Coro2b (235431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090500 GTTGTCGTCAACGGCATAGAT pLKO.1 1262 CDS 100% 5.625 7.875 N Coro2b n/a
2 TRCN0000316135 GTTGTCGTCAACGGCATAGAT pLKO_005 1262 CDS 100% 5.625 7.875 N Coro2b n/a
3 TRCN0000090499 CCCATCACCAAGAATGTACAT pLKO.1 110 CDS 100% 4.950 3.465 N Coro2b n/a
4 TRCN0000090498 CCTACTTTACAGTGAAGGTAA pLKO.1 2723 3UTR 100% 4.950 3.465 N Coro2b n/a
5 TRCN0000316127 CCTACTTTACAGTGAAGGTAA pLKO_005 2723 3UTR 100% 4.950 3.465 N Coro2b n/a
6 TRCN0000090502 CTATGACTACAAGGTCCTCAT pLKO.1 478 CDS 100% 4.050 2.835 N Coro2b n/a
7 TRCN0000316129 CTATGACTACAAGGTCCTCAT pLKO_005 478 CDS 100% 4.050 2.835 N Coro2b n/a
8 TRCN0000090501 GCCGTGTTCTACAGGAGGCAA pLKO.1 642 CDS 100% 0.880 0.616 N Coro2b n/a
9 TRCN0000316055 GCCGTGTTCTACAGGAGGCAA pLKO_005 642 CDS 100% 0.880 0.616 N Coro2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07593 pDONR223 100% 91.2% 97.8% None (many diffs) n/a
2 ccsbBroad304_07593 pLX_304 0% 91.2% 97.8% V5 (many diffs) n/a
3 TRCN0000479922 CGACATGGTAAGTCGCGGGATCGC pLX_317 25% 91.2% 97.8% V5 (many diffs) n/a
Download CSV