Transcript: Human NM_001190456.1

Homo sapiens coronin 2B (CORO2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
CORO2B (10391)
Length:
3344
CDS:
76..1503

Additional Resources:

NCBI RefSeq record:
NM_001190456.1
NBCI Gene record:
CORO2B (10391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108375 CGCATCCGTATAGCACTTTAA pLKO.1 2717 3UTR 100% 13.200 18.480 N CORO2B n/a
2 TRCN0000108377 GTTGTGGTCAACGGAATAGAT pLKO.1 1315 CDS 100% 5.625 3.938 N CORO2B n/a
3 TRCN0000108379 CTACGAGATCAGCACTGAGAA pLKO.1 951 CDS 100% 4.950 3.465 N CORO2B n/a
4 TRCN0000108376 CCAGGAAGACATTTACCCAAT pLKO.1 1152 CDS 100% 4.050 2.835 N CORO2B n/a
5 TRCN0000108378 GATGTCTTTGAAAGAAGGCTA pLKO.1 1242 CDS 100% 2.640 1.848 N CORO2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07593 pDONR223 100% 99.8% 99.7% None 697C>G;762C>T n/a
2 ccsbBroad304_07593 pLX_304 0% 99.8% 99.7% V5 697C>G;762C>T n/a
3 TRCN0000479922 CGACATGGTAAGTCGCGGGATCGC pLX_317 25% 99.8% 99.7% V5 697C>G;762C>T n/a
Download CSV