Construct: ORF TRCN0000479968
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012226.1_s317c1
- Derived from:
- ccsbBroadEn_00894
- DNA Barcode:
- CAGCTTGAACAGCCCGGGCCTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNJ1 (3758)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479968
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3758 | KCNJ1 | potassium inwardly rectifyi... | NM_000220.5 | 100% | 100% | |
2 | human | 3758 | KCNJ1 | potassium inwardly rectifyi... | NM_153765.2 | 96.5% | 95.7% | (many diffs) |
3 | human | 3758 | KCNJ1 | potassium inwardly rectifyi... | NM_153764.2 | 95.1% | 95.1% | 0_1ins57 |
4 | human | 3758 | KCNJ1 | potassium inwardly rectifyi... | NM_153766.2 | 95.1% | 95.1% | 0_1ins57 |
5 | human | 3758 | KCNJ1 | potassium inwardly rectifyi... | NM_153767.3 | 95.1% | 95.1% | 0_1ins57 |
6 | mouse | 56379 | Kcnj1 | potassium inwardly-rectifyi... | NM_001168354.1 | 86.8% | 90.5% | (many diffs) |
7 | mouse | 56379 | Kcnj1 | potassium inwardly-rectifyi... | NM_019659.3 | 83.7% | 88.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1242
- ORF length:
- 1173
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatgcttcc agtcggaatg tgtttgacac gttgatcagg gtgttgacag 121 aaagtatgtt caaacatctt cggaaatggg tcgtcactcg cttttttggg cattctcggc 181 aaagagcaag gctagtctcc aaagatggaa ggtgcaacat agaatttggc aatgtggagg 241 cacagtcaag gtttatattc tttgtggaca tctggacaac ggtacttgac ctcaagtgga 301 gatacaaaat gaccattttc atcacagcct tcttggggag ttggtttttc tttggtctcc 361 tgtggtatgc agtagcgtac attcacaaag acctcccgga attccatcct tctgccaatc 421 acactccctg tgtggagaat attaatggct tgacctcagc ttttctgttt tctctggaga 481 ctcaagtgac cattggatat ggattcaggt gtgtgacaga acagtgtgcc actgccattt 541 ttctgcttat ctttcagtct atacttggag ttataatcaa ttctttcatg tgtggggcca 601 tcttagccaa gatctccagg cccaaaaaac gtgccaagac cattacgttc agcaagaacg 661 cagtgatcag caaacgggga gggaagcttt gcctcctaat ccgagtggct aatctcagga 721 agagccttct tattggcagt cacatttatg gaaagcttct gaagaccaca gtcactcctg 781 aaggagagac cattattttg gaccagatca atatcaactt tgtagttgac gctgggaatg 841 aaaatttatt cttcatctcc ccattgacaa tttaccatgt cattgatcac aacagccctt 901 tcttccacat ggcagcggag acccttctcc agcaggactt tGAATTAGTG GTGTTTTTAG 961 ATGGCACAGT GGAGTCCACC AGTGCTACCT GCCAAGTCCG GACATCCTAT GTCCCAGAGG 1021 AGGTGCTTTG GGGCTACCGT TTTGCTCCCA TAGTATCCAA GACAAAGGAA GGGAAATACC 1081 GAGTGGATTT CCATAACTTT AGCAAGACAG TGGAAGTGGA GACCCCTCAC TGTGCCATGT 1141 GCCTTTATAA TGAGAAAGAT GTTAGAGCCA GGATGAAGAG AGGCTATGAC AACCCCAACT 1201 TCATCTTGTC AGAAGTCAAT GAAACAGATG ACACCAAAAT GTTGCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGACAG CTTGAACAGC CCGGGCCTTG TACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t