Transcript: Mouse NM_001168354.1

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 1 (Kcnj1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnj1 (56379)
Length:
3075
CDS:
160..1338

Additional Resources:

NCBI RefSeq record:
NM_001168354.1
NBCI Gene record:
Kcnj1 (56379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068526 CCTAACTTTGTCTTGTCAGAA pLKO.1 1288 CDS 100% 4.950 6.930 N Kcnj1 n/a
2 TRCN0000068525 CGAGTAGCAAATCTTAGGAAA pLKO.1 796 CDS 100% 4.950 6.930 N Kcnj1 n/a
3 TRCN0000068527 CCGAGTGGATTTCCATAACTT pLKO.1 1173 CDS 100% 5.625 3.938 N Kcnj1 n/a
4 TRCN0000068523 CCTCCAACAATCACATACAAA pLKO.1 2185 3UTR 100% 5.625 3.938 N Kcnj1 n/a
5 TRCN0000005596 CGAGTGGATTTCCATAACTTT pLKO.1 1174 CDS 100% 5.625 3.938 N KCNJ1 n/a
6 TRCN0000068524 CGCACATCATACATCCCAGAA pLKO.1 1093 CDS 100% 4.050 2.835 N Kcnj1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2578 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00894 pDONR223 100% 86.8% 90.5% None (many diffs) n/a
2 ccsbBroad304_00894 pLX_304 0% 86.8% 90.5% V5 (many diffs) n/a
3 TRCN0000479968 CAGCTTGAACAGCCCGGGCCTTGT pLX_317 26% 86.8% 90.5% V5 (many diffs) n/a
Download CSV