Construct: ORF TRCN0000479990
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009739.1_s317c1
- Derived from:
- ccsbBroadEn_12311
- DNA Barcode:
- ATATGGCGGGCTCGCCCCCTCGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STARD7 (56910)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479990
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56910 | STARD7 | StAR related lipid transfer... | XM_011511499.2 | 90.9% | 90.8% | 0_1ins78;116G>C;303T>C |
| 2 | human | 56910 | STARD7 | StAR related lipid transfer... | NM_020151.3 | 79.5% | 79.4% | 1_225del;419G>C;606T>C |
| 3 | mouse | 99138 | Stard7 | START domain containing 7 | NM_139308.2 | 70.6% | 74.2% | (many diffs) |
| 4 | mouse | 99138 | Stard7 | START domain containing 7 | XM_017319355.1 | 58.7% | 61.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgttagcc ggcgtcttcg tttgggacga ggagaggatc caggaggagg 121 agttgcagag atctattaat gagatgaagc ggttggaaga aatgtcaaat atgtttcaga 181 gctctggagt ccagcaccac cctccagaac caaaagccca aacagaaggg aatgaagatt 241 cagagggcaa agagcaacct tgggaaatgg tgatggataa gaaacacttt aagctgtggc 301 ggcgcccaat tacaggcacc cacctttacc agtaccgagt ttttggaacc tacacagatg 361 tgacacctcg gcagttcttc aatgttcagc tggacacaga gtatagaaaa aaatgggatg 421 ccctggtaat caagctggag gtgatcgaga gggatgtggt tagtggttcc gaggttcttc 481 actgggtaac ccattttccT TATCCAATGT ACTCACGGGA TTATGTTTAT GTTCGGCGGT 541 ATAGTGTGGA TCAGGAAAAC AACATGATGG TGTTGGTGTC GCGTGCTGTG GAGCATCCGA 601 GTGTGCCAGA GTCTCCAGAA TTCGTCAGGG TCAGATCATA TGAATCCCAA ATGGTTATCC 661 GTCCCCACAA GTCATTTGAT GAGAATGGCT TTGACTACTT ACTAACATAC AGTGACAATC 721 CCCAAACGGT GTTTCCTCGC TACTGTGTTA GTTGGATGGT TTCCAGTGGC ATGCCAGATT 781 TCCTGGAGAA GCTGCACATG GCCACTCTGA AAGCCAAGAA TATGGAGATT AAAGTAAAGG 841 ACTACATCTC AGCTAAGCCT CTGGAAATGA GTAGTGAAGC CAAGGCCACC AGCCAGTCCT 901 CTGAGCGAAA GAACGAGGGC AGCTGTGGCC CTGCTCGGAT TGAGTATGCT TGCCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGAATAT GGCGGGCTCG CCCCCTCGCC ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt