Transcript: Mouse XM_017319355.1

PREDICTED: Mus musculus START domain containing 7 (Stard7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stard7 (99138)
Length:
3374
CDS:
381..1730

Additional Resources:

NCBI RefSeq record:
XM_017319355.1
NBCI Gene record:
Stard7 (99138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105123 TCCAATGTACTCTCGTGATTA pLKO.1 1280 CDS 100% 13.200 18.480 N Stard7 n/a
2 TRCN0000325883 TCCAATGTACTCTCGTGATTA pLKO_005 1280 CDS 100% 13.200 18.480 N Stard7 n/a
3 TRCN0000105124 GAAAGACTACATCTCGGCTAA pLKO.1 1613 CDS 100% 4.050 5.670 N Stard7 n/a
4 TRCN0000325885 GAAAGACTACATCTCGGCTAA pLKO_005 1613 CDS 100% 4.050 5.670 N Stard7 n/a
5 TRCN0000105121 CGGTTGGAAGAAATGTCAAAT pLKO.1 699 CDS 100% 13.200 10.560 N Stard7 n/a
6 TRCN0000151458 CGGTTGGAAGAAATGTCAAAT pLKO.1 699 CDS 100% 13.200 10.560 N STARD7 n/a
7 TRCN0000280816 CGGTTGGAAGAAATGTCAAAT pLKO_005 699 CDS 100% 13.200 10.560 N STARD7 n/a
8 TRCN0000325866 CGGTTGGAAGAAATGTCAAAT pLKO_005 699 CDS 100% 13.200 10.560 N Stard7 n/a
9 TRCN0000105120 GCTGGTTTCTTTATGGTGAAT pLKO.1 2838 3UTR 100% 4.950 3.465 N Stard7 n/a
10 TRCN0000325811 GCTGGTTTCTTTATGGTGAAT pLKO_005 2838 3UTR 100% 4.950 3.465 N Stard7 n/a
11 TRCN0000105122 CTGAGGTTCTTCATTGGGTAA pLKO.1 1246 CDS 100% 4.050 2.835 N Stard7 n/a
12 TRCN0000325809 CTGAGGTTCTTCATTGGGTAA pLKO_005 1246 CDS 100% 4.050 2.835 N Stard7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12311 pDONR223 100% 58.7% 61.6% None (many diffs) n/a
2 ccsbBroad304_12311 pLX_304 0% 58.7% 61.6% V5 (many diffs) n/a
3 TRCN0000479990 ATATGGCGGGCTCGCCCCCTCGCC pLX_317 51% 58.7% 61.6% V5 (many diffs) n/a
4 ccsbBroadEn_14221 pDONR223 100% 58.6% 61.2% None (many diffs) n/a
5 ccsbBroad304_14221 pLX_304 0% 58.6% 61.2% V5 (many diffs) n/a
6 TRCN0000477506 TGAGACAACACATCTAGCTGGACT pLX_317 59.3% 58.6% 61.2% V5 (many diffs) n/a
Download CSV