Transcript: Human NM_020151.3

Homo sapiens StAR related lipid transfer domain containing 7 (STARD7), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
STARD7 (56910)
Length:
3394
CDS:
402..1514

Additional Resources:

NCBI RefSeq record:
NM_020151.3
NBCI Gene record:
STARD7 (56910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156211 CCAATGTACTCACGGGATTAT pLKO.1 1065 CDS 100% 13.200 18.480 N STARD7 n/a
2 TRCN0000280819 CCAATGTACTCACGGGATTAT pLKO_005 1065 CDS 100% 13.200 18.480 N STARD7 n/a
3 TRCN0000105121 CGGTTGGAAGAAATGTCAAAT pLKO.1 711 CDS 100% 13.200 9.240 N Stard7 n/a
4 TRCN0000151458 CGGTTGGAAGAAATGTCAAAT pLKO.1 711 CDS 100% 13.200 9.240 N STARD7 n/a
5 TRCN0000280816 CGGTTGGAAGAAATGTCAAAT pLKO_005 711 CDS 100% 13.200 9.240 N STARD7 n/a
6 TRCN0000325866 CGGTTGGAAGAAATGTCAAAT pLKO_005 711 CDS 100% 13.200 9.240 N Stard7 n/a
7 TRCN0000155559 CCTGGGTTATGTCCAAACTTA pLKO.1 3103 3UTR 100% 5.625 3.938 N STARD7 n/a
8 TRCN0000155648 GCTGGACACAGAGTATAGAAA pLKO.1 950 CDS 100% 5.625 3.938 N STARD7 n/a
9 TRCN0000280817 GCTGGACACAGAGTATAGAAA pLKO_005 950 CDS 100% 5.625 3.938 N STARD7 n/a
10 TRCN0000156682 GCCTGCACAATATCACCCATT pLKO.1 2183 3UTR 100% 4.050 2.835 N STARD7 n/a
11 TRCN0000280742 GCCTGCACAATATCACCCATT pLKO_005 2183 3UTR 100% 4.050 2.835 N STARD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020151.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14221 pDONR223 100% 79.6% 79.4% None 1_225del;478A>G n/a
2 ccsbBroad304_14221 pLX_304 0% 79.6% 79.4% V5 1_225del;478A>G n/a
3 TRCN0000477506 TGAGACAACACATCTAGCTGGACT pLX_317 59.3% 79.6% 79.4% V5 1_225del;478A>G n/a
4 ccsbBroadEn_12311 pDONR223 100% 79.5% 79.4% None 1_225del;419G>C;606T>C n/a
5 ccsbBroad304_12311 pLX_304 0% 79.5% 79.4% V5 1_225del;419G>C;606T>C n/a
6 TRCN0000479990 ATATGGCGGGCTCGCCCCCTCGCC pLX_317 51% 79.5% 79.4% V5 1_225del;419G>C;606T>C n/a
Download CSV