Construct: ORF TRCN0000480009
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003697.1_s317c1
- Derived from:
- ccsbBroadEn_07743
- DNA Barcode:
- GTATGCACGTCATATTAGGGCATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPPP (11076)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480009
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 11076 | TPPP | tubulin polymerization prom... | NM_007030.3 | 99.6% | 100% | 114T>C;597A>G |
2 | human | 11076 | TPPP | tubulin polymerization prom... | XM_005248237.3 | 99.6% | 100% | 114T>C;597A>G |
3 | human | 11076 | TPPP | tubulin polymerization prom... | XM_024454346.1 | 99.6% | 100% | 114T>C;597A>G |
4 | human | 11076 | TPPP | tubulin polymerization prom... | XM_017008993.1 | 76.3% | 76.5% | 1_201del;315T>C;798A>G |
5 | mouse | 72948 | Tppp | tubulin polymerization prom... | NM_182839.2 | 85.3% | 91.8% | (many diffs) |
6 | mouse | 72948 | Tppp | tubulin polymerization prom... | XM_006517409.3 | 85.3% | 91.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 726
- ORF length:
- 657
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgacaag gccaagcctg ccaaagctgc caacaggacg ccccccaagt 121 ccccggggga cccctcgaag gaccgggcag ccaagaggct gtcgctggaa tcggagggtg 181 ccggtgaggg ggcagccgca tcccctgagc tcagtgccct ggaggaggcc ttccggcgct 241 ttgccgtgca cggggacgcc agggccaccg ggagggagat gcacggcaag aactggtcga 301 agctgtgcaa ggactgccag gtgatcgacg gcaggaacgt gaccgtcact gacgtggaca 361 tcgtcTTCAG CAAGATCAAA GGGAAGTCTT GCCGGACCAT CACCTTTGAG CAGTTCCAGG 421 AGGCGCTGGA GGAGCTCGCC AAGAAGCGAT TCAAAGACAA GAGCAGCGAG GAGGCCGTTC 481 GCGAGGTGCA CAGGCTCATC GAGGGCAAGG CGCCCATCAT CTCAGGGGTG ACGAAAGCCA 541 TCTCGTCGCC CACAGTGTCG AGGCTCACGG ACACCACCAA GTTCACGGGC TCCCACAAGG 601 AGCGCTTCGA CCCCTCTGGC AAGGGCAAGG GCAAGGCTGG CCGCGTGGAT CTGGTGGACG 661 AGTCGGGCTA TGTGTCCGGC TACAAGCACG CAGGCACCTA CGACCAGAAG GTGCAAGGGG 721 GCAAGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 781 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 841 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTATGCACG TCATATTAGG GCATCACGCG 901 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt