Transcript: Human NM_007030.3

Homo sapiens tubulin polymerization promoting protein (TPPP), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TPPP (11076)
Length:
5979
CDS:
80..739

Additional Resources:

NCBI RefSeq record:
NM_007030.3
NBCI Gene record:
TPPP (11076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165449 GCGTGTGAAAGGCAGAACTAA pLKO.1 2555 3UTR 100% 5.625 4.500 N TPPP n/a
2 TRCN0000160775 CCTCAGTCAGTTTCTGAATAT pLKO.1 4207 3UTR 100% 13.200 9.240 N TPPP n/a
3 TRCN0000164184 CCAGGTAGTGTTCCTAACAAT pLKO.1 4781 3UTR 100% 5.625 3.938 N TPPP n/a
4 TRCN0000162530 CAAGAAGCGATTCAAAGACAA pLKO.1 451 CDS 100% 4.950 3.465 N TPPP n/a
5 TRCN0000165509 GACCATCACCTTTGAGCAGTT pLKO.1 406 CDS 100% 4.050 2.835 N TPPP n/a
6 TRCN0000162353 CCTAACAATTAGCGTTACCAA pLKO.1 4793 3UTR 100% 3.000 2.100 N TPPP n/a
7 TRCN0000163670 GCAAGATCAAAGGGAAGTCTT pLKO.1 381 CDS 100% 4.950 2.970 N TPPP n/a
8 TRCN0000163799 GCTTTGCTTTCCTGAGAAGAT pLKO.1 1470 3UTR 100% 4.950 2.970 N TPPP n/a
9 TRCN0000161886 GCACTTCATTACATTCCTGTA pLKO.1 799 3UTR 100% 4.050 2.430 N TPPP n/a
10 TRCN0000165541 GCGATTCAAAGACAAGAGCAG pLKO.1 457 CDS 100% 2.160 1.296 N TPPP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02614 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02614 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473628 TTCTCGCGTGCGAAAACGCTCCAA pLX_317 66.1% 100% 100% V5 n/a
4 ccsbBroadEn_07743 pDONR223 100% 99.6% 100% None 114T>C;597A>G n/a
5 ccsbBroad304_07743 pLX_304 0% 99.6% 100% V5 114T>C;597A>G n/a
6 TRCN0000480009 GTATGCACGTCATATTAGGGCATC pLX_317 54.5% 99.6% 100% V5 114T>C;597A>G n/a
Download CSV