Transcript: Mouse NM_182839.2

Mus musculus tubulin polymerization promoting protein (Tppp), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tppp (72948)
Length:
5108
CDS:
96..752

Additional Resources:

NCBI RefSeq record:
NM_182839.2
NBCI Gene record:
Tppp (72948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_182839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257798 TCATCTCTGGCGTCACGAAAG pLKO_005 541 CDS 100% 6.000 8.400 N Tppp n/a
2 TRCN0000248370 CAAGGAGCGTTTCGACCAATC pLKO_005 620 CDS 100% 6.000 4.800 N Tppp n/a
3 TRCN0000248371 TGGAGTGACAGAGTCATATTT pLKO_005 3685 3UTR 100% 15.000 10.500 N Tppp n/a
4 TRCN0000248373 TTGTCTTCAGCAAGATCAAAG pLKO_005 385 CDS 100% 10.800 7.560 N Tppp n/a
5 TRCN0000192053 CCCAGGAAACAAAGGATACAT pLKO.1 3559 3UTR 100% 5.625 3.938 N Tppp n/a
6 TRCN0000248372 GGCTATGTGCCTGGTTACAAG pLKO_005 690 CDS 100% 4.950 3.465 N Tppp n/a
7 TRCN0000190342 CGTGGACATTGTCTTCAGCAA pLKO.1 377 CDS 100% 2.640 1.848 N Tppp n/a
8 TRCN0000165509 GACCATCACCTTTGAGCAGTT pLKO.1 419 CDS 100% 4.050 2.430 N TPPP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02614 pDONR223 100% 85.3% 91.8% None (many diffs) n/a
2 ccsbBroad304_02614 pLX_304 0% 85.3% 91.8% V5 (many diffs) n/a
3 TRCN0000473628 TTCTCGCGTGCGAAAACGCTCCAA pLX_317 66.1% 85.3% 91.8% V5 (many diffs) n/a
4 ccsbBroadEn_07743 pDONR223 100% 85.3% 91.8% None (many diffs) n/a
5 ccsbBroad304_07743 pLX_304 0% 85.3% 91.8% V5 (many diffs) n/a
6 TRCN0000480009 GTATGCACGTCATATTAGGGCATC pLX_317 54.5% 85.3% 91.8% V5 (many diffs) n/a
Download CSV