Construct: ORF TRCN0000480102
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008392.1_s317c1
- Derived from:
- ccsbBroadEn_09078
- DNA Barcode:
- ATGGCGTAAACACAGTCAACTGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ITM2C (81618)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480102
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81618 | ITM2C | integral membrane protein 2C | NM_001012516.2 | 99.4% | 99.5% | (many diffs) |
2 | human | 81618 | ITM2C | integral membrane protein 2C | NM_001287241.2 | 85.6% | 85.7% | (many diffs) |
3 | human | 81618 | ITM2C | integral membrane protein 2C | NM_030926.6 | 85.6% | 85.7% | (many diffs) |
4 | human | 81618 | ITM2C | integral membrane protein 2C | NM_001012514.3 | 68.4% | 68.5% | 119_120ins141;309_419del;657G>A |
5 | human | 81618 | ITM2C | integral membrane protein 2C | NM_001287240.2 | 62.5% | 62.9% | (many diffs) |
6 | mouse | 64294 | Itm2c | integral membrane protein 2C | NM_022417.3 | 74.3% | 78.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 756
- ORF length:
- 690
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaagattagc ttccagcccg ccgtggctgg catcaagggc gacaaggctg 121 acaaggcgtc ggcgtcggcc cctgcgccgg cctcggccac cgagatcctg ctgacgccgg 181 ctagggagga gcagccccca caacatcgat ccaagagggg gagctcagtg ggcggcgtgt 241 gctacctgtc gatgggcatg gtcgtgctgc tcatgggcct cgtgttcgcc tctgtctaca 301 tctacagata cttctttctt gcacagctgg cccgagataa cttcttccgc tgtggtgtgc 361 tgtatgagga ctccctgtcc tcccaggtcc ggacTCAGAT GGAGCTGGAA GAGGATGTGA 421 AAATCTACCT CGACGAGAAC TACGAGCGCA TCAACGTGCC TGTGCCCCAG TTTGGCGGCG 481 GTGACCCTGC AGACATCATC CATGACTTCC AGCGGAGGGG GACCTACCTG CCGCAGACGT 541 ACATCATCCA GGAGGAGATG GTGGTCACGG AGCATGTCAG TGACAAGGAG GCCCTGGGGT 601 CCTTCATCTA CCACCTGTGC AACGGGAAAG ACACCTACCG GCTCCGGCGC CGGGCAACGC 661 GGAGGCGGAT CAACAAGCGT GGGGCCAAGA ACTGCAATGC CATCCGCCAC TTCGAGAACA 721 CCTTCGTGGT GGAGACGCTC ATCTGCGGGG TAGTGTGCCC AACTTTCTTG TACAAAGTGG 781 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 841 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 901 AATGGCGTAA ACACAGTCAA CTGGTACGCG TTAAGTCgac aatcaacctc tggattacaa 961 aatttgtgaa agatt