Transcript: Human NM_001287241.2

Homo sapiens integral membrane protein 2C (ITM2C), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ITM2C (81618)
Length:
2629
CDS:
677..1480

Additional Resources:

NCBI RefSeq record:
NM_001287241.2
NBCI Gene record:
ITM2C (81618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156662 GCTTGTACTTTGGACGCGTTT pLKO.1 1565 3UTR 100% 4.050 5.670 N ITM2C n/a
2 TRCN0000154864 GACAAGTGCTATGTCATCGAA pLKO.1 1157 CDS 100% 3.000 4.200 N ITM2C n/a
3 TRCN0000156941 GATAACTTCTTCCGCTGTGGT pLKO.1 947 CDS 100% 2.640 3.696 N ITM2C n/a
4 TRCN0000157813 CGAACTCAACACCACCATTGT pLKO.1 1174 CDS 100% 4.950 3.960 N ITM2C n/a
5 TRCN0000156586 GAGCTGGAAGAGGATGTGAAA pLKO.1 1013 CDS 100% 4.950 3.465 N ITM2C n/a
6 TRCN0000154865 GCTATGTCATCGAACTCAACA pLKO.1 1164 CDS 100% 4.950 3.465 N ITM2C n/a
7 TRCN0000156963 GTTCGCCTCTGTCTACATCTA pLKO.1 895 CDS 100% 4.950 3.465 N ITM2C n/a
8 TRCN0000156771 GCAGACATCATCCATGACTTC pLKO.1 1100 CDS 100% 4.050 2.835 N ITM2C n/a
9 TRCN0000158284 CGAGATAACTTCTTCCGCTGT pLKO.1 944 CDS 100% 2.160 1.512 N ITM2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287241.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09078 pDONR223 100% 85.6% 85.7% None (many diffs) n/a
2 TRCN0000480102 ATGGCGTAAACACAGTCAACTGGT pLX_317 52.3% 85.6% 85.7% V5 (many diffs) n/a
3 ccsbBroadEn_04247 pDONR223 100% 82.3% 82.3% None 120_260del n/a
4 ccsbBroad304_04247 pLX_304 0% 82.3% 82.3% V5 120_260del n/a
5 TRCN0000480461 TGGTAACACGCATGTACCCTTGCC pLX_317 62.7% 82.3% 82.3% V5 120_260del n/a
Download CSV