Construct: ORF TRCN0000480249
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004104.1_s317c1
- Derived from:
- ccsbBroadEn_11752
- DNA Barcode:
- ACCTTGCTTTTATCTCTCATGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDSS1 (23590)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480249
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | NM_001321978.1 | 99.8% | 99.6% | 89G>T |
| 2 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | XM_024447922.1 | 81.6% | 79.2% | (many diffs) |
| 3 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | NM_014317.5 | 73.5% | 67.7% | (many diffs) |
| 4 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | XM_017016011.2 | 47.5% | 41.1% | (many diffs) |
| 5 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | XM_011519437.3 | 44% | 38.4% | (many diffs) |
| 6 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | XR_428636.4 | 39.6% | (many diffs) | |
| 7 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | NM_001321979.1 | 32.6% | 27.1% | (many diffs) |
| 8 | human | 23590 | PDSS1 | decaprenyl diphosphate synt... | XM_024447923.1 | 32.6% | 27.1% | (many diffs) |
| 9 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XM_006498188.3 | 66.3% | 57.1% | (many diffs) |
| 10 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | NM_019501.3 | 60.4% | 52.4% | (many diffs) |
| 11 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XM_017319134.1 | 54.2% | 47.1% | (many diffs) |
| 12 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XM_006498189.3 | 53.7% | 46.6% | (many diffs) |
| 13 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XR_001783152.1 | 48.2% | (many diffs) | |
| 14 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XR_374108.3 | 44.9% | (many diffs) | |
| 15 | mouse | 56075 | Pdss1 | prenyl (solanesyl) diphosph... | XM_006498191.3 | 33.4% | 28.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 984
- ORF length:
- 918
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctcgcgctgg tggcggtggc ggcgcggctg ctcctggaag ccggcggcgc 121 ggagccccgg gcccggctcc cccggccgtg cggtaccgtt ggggccgagc gccgctgccg 181 aagtccgcgc gcaggttcat aggcggaagg gacttgactt gtctcagata ccctatatta 241 atcttgtgaa gcatttaaca tctgcctgtc caaatgtatg tcgtatatca cggtttcatc 301 acacaacccc agacagtaaa acacacagtg gtgaaaaata caccgatcct ttcaaactcg 361 gttggagaga cttgaaaggt ctgtatgagg acattagaaa ggaactgctt atatcaacat 421 cagaacttaa ggaaatgtct gagtactact ttgatgggaa agggaaagcc tttcgaccaa 481 ttattgtggc gctaatggcc cgagcatgca atattcatca taacaactcc cgacatgtgc 541 aagccagcca gcgcgccata gccttaattg cagaaatgaT CCACACTGCT AGTCTGGTTC 601 ACGATGACGT TATTGACGAT GCAAGTTCTC GAAGAGGAAA ACACACAGTT AATAAGATCT 661 GGGGTGAAAA GAAGGCTGTT CTTGCTGGAG ATTTAATTCT TTCTGCAGCA TCTATAGCTC 721 TGGCACGAAT TGGAAATACA ACTGTTATAT CTATTTTAAC CCAAGTTATT GAAGATTTGG 781 TGCGTGGTGA ATTTCTTCAG CTCGGGTCAA AAGAAAATGA GAATGAAAGA TTTGCACACT 841 ACCTTGAGAA GACATTCAAG AAGACCGCCA GCCTGATAGC CAACAGTTGT AAAGCAGTAT 901 TTCCCAGAAA TGAATGCTAT GATCATGCGA CGGTTCAGTT TGCCTGGAGA TGTAGACAGA 961 GCTCGACAGT ATGTACTACA GAGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1021 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1081 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CCTTGCTTTT 1141 ATCTCTCATG CCCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1201 att