Construct: ORF TRCN0000480277
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002483.1_s317c1
- Derived from:
- ccsbBroadEn_11526
- DNA Barcode:
- AGCCAAAAGTAGGCTAGTCCGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TXNRD2 (10587)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480277
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_001352301.1 | 99.4% | 99.7% | 1019T>C;1116G>A;1477_1482delTGAGGG |
2 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_001352300.2 | 93.8% | 93.4% | (many diffs) |
3 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_006440.5 | 93.6% | 93.2% | (many diffs) |
4 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_001352302.1 | 86% | 86.3% | (many diffs) |
5 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NR_147957.2 | 71.7% | (many diffs) | |
6 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_001352303.1 | 59.7% | 58.1% | (many diffs) |
7 | human | 10587 | TXNRD2 | thioredoxin reductase 2 | NM_001282512.3 | 56.5% | 54.4% | (many diffs) |
8 | mouse | 26462 | Txnrd2 | thioredoxin reductase 2 | NM_013711.3 | 78.7% | 80.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1545
- ORF length:
- 1476
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggaccaa gcaggtcagc gggactatga tctcctggtg gtcggcgggg 121 gatctggtgg cctggcttgt gccaaggagg ccgcccagct gggaaggaag gtggccgtgg 181 tggactacgt ggaaccttct ccccaaggca cccggtgggg cctcggcggc acctgcgtca 241 acgtgggctg catccccaag aagctgatgc accaggcggc actgctggga ggcctgatcc 301 aagatgcccc caactatggc tgggaggtgg cccagcccgt gccgcatgac tggaggaaga 361 tggcagaagc tgttcaaaat cacgtgaaat ccttgaactg gggccaccgt gtccagcttc 421 aggacagaaa agtcaagtac tttaacatca aagccagctt tgttgacgag cacacggttt 481 gcggcgttgc caaaggtggg aaagagattc tgctgtcagc cgatcacatc atcattgcta 541 ctggagggcg gccgagatac cccacgcaca tcgaaggtgc cttggaatat ggaatcacaa 601 gtgatgacat cttctggctg aaggaatccc ctggaaaaac gttggtggtc ggggccagct 661 atgtggccct ggagtgtgct ggcttcctca ccgggattgg gctggacacc accatcatga 721 tgcgcagcat ccccctccgc ggcttcgacc agcaaatgtc ctccatggtc atagagcaca 781 tggcatctca tggcacccgg ttcctgaggg gctgtgcccc ctcgcgggtc aggaggctcc 841 ctgatggcca gctgcaggtc acctgggagg acagcaccac cggcaaggag gacacgggca 901 cctttgacac cgtcctgtgg gccataggtc gagtcccaga caccagaagt ctgaatttgg 961 agaaggctgg ggtagatact agccccgaca ctcagaagat cctggtggac tcccgggaag 1021 ccacctctgt gccccacatc tacgccattg gtgacgtggt ggaggggcgg cctgagctga 1081 cacccacagc gatcatggcc gggaggctcc tggtgcagcg gctcttcggc gggtcctcag 1141 atctgatgga ctacgacaat gttcccacga CCGTCTTCAC CCCACTGGAG TATGGCTGTG 1201 TGGGGCTGTC CGAGGAGGAG GCAGTGGCTC GCCACGGGCA GGAGCATGTT GAGGTCTATC 1261 ACGCCCATTA TAAACCACTG GAGTTCACGG TGGCTGGACG AGATGCATCC CAGTGTTATG 1321 TAAAGATGGT GTGCCTGAGG GAGCCCCCAC AGCTGGTGCT GGGCCTGCAT TTCCTTGGCC 1381 CCAACGCAGG CGAAGTTACT CAAGGATTTG CTCTGGGGAT CAAGTGTGGG GCTTCCTATG 1441 CGCAGGTGAT GCGGACCGTG GGTATCCATC CCACATGCTC TGAGGAGGTA GTCAAGCTGC 1501 GCATCTCCAA GCGCTCAGGC CTGGACCCCA CGGTGACAGG CTGCTTGCCA ACTTTCTTGT 1561 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1621 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1681 GAAAGGACGA AGCCAAAAGT AGGCTAGTCC GGTCACGCGT TAAGTCgaca atcaacctct 1741 ggattacaaa atttgtgaaa gatt