Transcript: Human NM_006440.5

Homo sapiens thioredoxin reductase 2 (TXNRD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TXNRD2 (10587)
Length:
1941
CDS:
16..1590

Additional Resources:

NCBI RefSeq record:
NM_006440.5
NBCI Gene record:
TXNRD2 (10587)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006440.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046477 TCAGCCGATCACATCATCATT pLKO.1 553 CDS 100% 5.625 4.500 N TXNRD2 n/a
2 TRCN0000434681 ATAGAGCACATGGCATCTCAT pLKO_005 808 CDS 100% 4.950 3.960 N TXNRD2 n/a
3 TRCN0000046475 CTGATGGACTACGACAATGTT pLKO.1 1180 CDS 100% 5.625 3.938 N TXNRD2 n/a
4 TRCN0000433391 CTGACACCCATAGCGATCATG pLKO_005 1114 CDS 100% 4.950 3.465 N TXNRD2 n/a
5 TRCN0000046474 GAATATGGAATCACAAGTGAT pLKO.1 622 CDS 100% 4.950 3.465 N TXNRD2 n/a
6 TRCN0000046473 CCATTATAAACCACTGGAGTT pLKO.1 1302 CDS 100% 4.050 2.835 N TXNRD2 n/a
7 TRCN0000046476 CTTTAACATCAAAGCCAGCTT pLKO.1 477 CDS 100% 2.640 1.848 N TXNRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006440.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11526 pDONR223 100% 93.6% 93.2% None (many diffs) n/a
2 ccsbBroad304_11526 pLX_304 0% 93.6% 93.2% V5 (many diffs) n/a
3 TRCN0000480277 AGCCAAAAGTAGGCTAGTCCGGTC pLX_317 25.6% 93.6% 93.2% V5 (many diffs) n/a
Download CSV