Transcript: Mouse NM_013711.3

Mus musculus thioredoxin reductase 2 (Txnrd2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Txnrd2 (26462)
Length:
1922
CDS:
29..1612

Additional Resources:

NCBI RefSeq record:
NM_013711.3
NBCI Gene record:
Txnrd2 (26462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042343 CCCTGGAATATGGAATCACAA pLKO.1 639 CDS 100% 4.950 3.960 N Txnrd2 n/a
2 TRCN0000042346 CCAACACAACTGGAAGACAAT pLKO.1 400 CDS 100% 4.950 3.465 N Txnrd2 n/a
3 TRCN0000042345 GCAGCAGAGCTTTGATCTCTT pLKO.1 145 CDS 100% 4.950 3.465 N Txnrd2 n/a
4 TRCN0000042347 CAGTGCTACATAAAGATGGTA pLKO.1 1370 CDS 100% 3.000 2.100 N Txnrd2 n/a
5 TRCN0000046476 CTTTAACATCAAAGCCAGCTT pLKO.1 499 CDS 100% 2.640 1.848 N TXNRD2 n/a
6 TRCN0000042344 CCAAGGATTTGCTCTTGGGAT pLKO.1 1459 CDS 100% 0.264 0.185 N Txnrd2 n/a
7 TRCN0000046474 GAATATGGAATCACAAGTGAT pLKO.1 644 CDS 100% 4.950 3.465 N TXNRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11526 pDONR223 100% 78.7% 80.1% None (many diffs) n/a
2 ccsbBroad304_11526 pLX_304 0% 78.7% 80.1% V5 (many diffs) n/a
3 TRCN0000480277 AGCCAAAAGTAGGCTAGTCCGGTC pLX_317 25.6% 78.7% 80.1% V5 (many diffs) n/a
Download CSV