Construct: ORF TRCN0000480327
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009032.2_s317c1
- Derived from:
- ccsbBroadEn_00901
- DNA Barcode:
- AAGGTTGAGGTGAGAACAGGAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNN2 (3781)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480327
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3781 | KCNN2 | potassium calcium-activated... | NM_001278204.1 | 100% | 100% | |
| 2 | human | 3781 | KCNN2 | potassium calcium-activated... | NM_170775.3 | 100% | 100% | |
| 3 | human | 3781 | KCNN2 | potassium calcium-activated... | XM_017009457.1 | 84% | 84% | 1_132del |
| 4 | human | 3781 | KCNN2 | potassium calcium-activated... | NR_103458.2 | 43.9% | 1_462del;671_776del;1262_1578del | |
| 5 | human | 3781 | KCNN2 | potassium calcium-activated... | NM_021614.4 | 29.2% | 29.2% | 1_1680del |
| 6 | human | 3781 | KCNN2 | potassium calcium-activated... | NM_001372233.1 | 26.9% | 26.9% | 1_1878del |
| 7 | human | 3781 | KCNN2 | potassium calcium-activated... | XM_011543389.1 | 26.9% | 26.9% | 1_1878del |
| 8 | mouse | 140492 | Kcnn2 | potassium intermediate/smal... | NM_080465.2 | 36.8% | 39.7% | (many diffs) |
| 9 | mouse | 140492 | Kcnn2 | potassium intermediate/smal... | XM_030250332.1 | 25.1% | 27% | (many diffs) |
| 10 | mouse | 140492 | Kcnn2 | potassium intermediate/smal... | NM_001312905.2 | 24.9% | 26.8% | (many diffs) |
| 11 | mouse | 140492 | Kcnn2 | potassium intermediate/smal... | XM_030250331.1 | 24.8% | 26.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 759
- ORF length:
- 693
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gttgatatca ataacttttc tctccattgg ttatggtgac atggtaccta 121 acacatactg tggaaaagga gtctgcttac ttactggaat tatgggtgct ggttgcacag 181 ccctggtggt agctgtagtg gcaaggaagc tagaacttac caaagcagaa aaacacgtgc 241 acaatttcat gatggatact cagctgacta aaagagtaaa aaatgcagct gccaatgtac 301 tcagggaaac atggctaatt tacaaaaata caaagctagt gaaaaagata gatcatgcaa 361 aagtaagaaa acatcaacga aaattcctgc aagctattca TCAATTAAGA AGTGTAAAAA 421 TGGAGCAGAG GAAACTGAAT GACCAAGCAA ACACTTTGGT GGACTTGGCA AAGACCCAGA 481 ACATCATGTA TGATATGATT TCTGACTTAA ACGAAAGGAG TGAAGACTTC GAGAAGAGGA 541 TTGTTACCCT GGAAACAAAA CTAGAGACTT TGATTGGTAG CATCCACGCC CTCCCTGGGC 601 TCATAAGCCA GACCATCAGG CAGCAGCAGA GAGATTTCAT TGAGGCTCAG ATGGAGAGCT 661 ACGACAAGCA CGTCACTTAC AATGCTGAGC GGTCCCGGTC CTCGTCCAGG AGGCGGCGGT 721 CCTCTTCCAC AGCACCACCA ACTTCATCAG AGAGTAGCTA CCCAACTTTC TTGTACAAAG 781 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 841 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 901 ACGAAAGGTT GAGGTGAGAA CAGGAACCAC GCGTTAAGTC gacaatcaac ctctggatta 961 caaaatttgt gaaagatt