Construct: ORF TRCN0000480387
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001083.1_s317c1
- Derived from:
- ccsbBroadEn_05069
- DNA Barcode:
- GGTATACCCAAATGAGTTGCACCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC36A2 (153201)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480387
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 153201 | SLC36A2 | solute carrier family 36 me... | NM_181776.3 | 100% | 100% | |
| 2 | human | 153201 | SLC36A2 | solute carrier family 36 me... | XM_006714756.4 | 93.1% | 93.1% | 743_744ins99 |
| 3 | human | 153201 | SLC36A2 | solute carrier family 36 me... | XM_005268377.4 | 81.3% | 81.3% | 1179_1180ins270 |
| 4 | human | 153201 | SLC36A2 | solute carrier family 36 me... | XM_017009083.2 | 61.9% | 56.1% | (many diffs) |
| 5 | human | 153201 | SLC36A2 | solute carrier family 36 me... | XM_017009084.1 | 59% | 59% | 0_1ins594 |
| 6 | mouse | 246049 | Slc36a2 | solute carrier family 36 (p... | XM_006533324.3 | 78.6% | 75.5% | (many diffs) |
| 7 | mouse | 246049 | Slc36a2 | solute carrier family 36 (p... | XM_006533325.3 | 60.1% | 58.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1518
- ORF length:
- 1449
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctgtgaca aaaagtactg agggtcccca gggagccgtt gccatcaaat 121 tggaccttat gtcgcctcct gaaagtgcca agaagttgga gaacaaggac tctacattct 181 tggatgaaag tccttcagag tcagcaggct tgaagaagac caagggcata acagtgttcc 241 aggccttgat tcacctggtg aaaggcaaca tgggcacagg gatcctggga ctacccctcg 301 ctgtgaagaa cgcgggcatc ctgatgggcc cactcagtct gctggtgatg ggcttcattg 361 cctgccactg tatgcacatc ctggtcaagt gtgcccagcg cttctgtaag aggcttaaca 421 agccctttat ggactatggg gacacggtga tgcatggact agaagccaac cccaacgcct 481 ggctccagaa tcacgctcac tggggaaggc atatcgtgag cttcttcctt attatcaccc 541 aacttggctt ctgctgtgtg tacattgtgt ttttggctga taatttaaaa caggtagtgg 601 aagctgttaa tagcacaacc aacaactgct attccaatga gacggtgatt ctgaccccca 661 ccatggactc gcgactctac atgctctcct tcctgccctt cctggtgctg ctggtcctca 721 tccggaacct caggatcttg accatcttct ccatgctggc caacatcagc atgctggtca 781 gcttggtcat catcatacag tacattaccc aggaaatccc agaccccagc cggttgccac 841 tggtagcaag ctggaagacc taccctctct tcttcggaac agccattttt tcttttgaaa 901 gcattggtgt ggttctgcct ctggaaaaca agatgaagaa tgcccgccac ttcccagcca 961 tcctgtcttt gggaatgtcc atcgtcactt ccctatacat tggcatggcg gctctgggct 1021 acctgcggtt tggagatgac atcaaggcca gcataagcct taacctgcct aactgctggc 1081 tgtaccagtc tgtcaagctt ctctacattg ccggcatcct gtgcacctat gccctgcagt 1141 tctacgtccc tgcagaaatc atcaTCCCCT TTGCCATCTC CCGGGTGTCA ACACGCTGGG 1201 CACTGCCTCT GGATCTGTCC ATTCGCCTCG TCATGGTCTG CCTGACATGC CTCCTGGCCA 1261 TCCTCATCCC CCGCCTGGAC CTGGTCATCT CCCTGGTGGG CTCCGTGAGT GGCACCGCCC 1321 TGGCCCTCAT CATCCCACCG CTCCTGGAGG TCACCACGTT CTACTCAGAG GGCATGAGCC 1381 CCCTCACCAT CTTCAAGGAC GCCCTGATCA GCATCCTGGG CTTCGTGGGC TTTGTGGTGG 1441 GGACCTACCA GGCCCTGGAC GAGCTGCTCA AGTCAGAAGA CTCTCACCCC TTTTCCAACT 1501 CCACCACTTT TGTTCGGTTG CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1561 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1621 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGGTATAC CCAAATGAGT 1681 TGCACCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt