Transcript: Human XM_006714756.4

PREDICTED: Homo sapiens solute carrier family 36 member 2 (SLC36A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC36A2 (153201)
Length:
1544
CDS:
103..1455

Additional Resources:

NCBI RefSeq record:
XM_006714756.4
NBCI Gene record:
SLC36A2 (153201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006714756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044015 GACTCTACATTCTTGGATGAA pLKO.1 202 CDS 100% 4.950 6.930 N SLC36A2 n/a
2 TRCN0000343075 TCGTGAGCTTCTTCCTTATTA pLKO_005 548 CDS 100% 15.000 10.500 N SLC36A2 n/a
3 TRCN0000343143 GGTAGTGGAAGCTGTTAATAG pLKO_005 627 CDS 100% 13.200 9.240 N SLC36A2 n/a
4 TRCN0000343145 CATCATCATACAGTACATTAC pLKO_005 822 CDS 100% 10.800 7.560 N SLC36A2 n/a
5 TRCN0000044016 GCACAACCAACAACTGCTATT pLKO.1 647 CDS 100% 10.800 7.560 N SLC36A2 n/a
6 TRCN0000044014 GCGCTTCTGTAAGAGGCTTAA pLKO.1 432 CDS 100% 10.800 7.560 N SLC36A2 n/a
7 TRCN0000343073 TGCCATCAAATTGGACCTTAT pLKO_005 144 CDS 100% 10.800 7.560 N SLC36A2 n/a
8 TRCN0000044013 CCTCAGGATCTTGACCATCTT pLKO.1 762 CDS 100% 4.950 3.465 N SLC36A2 n/a
9 TRCN0000044017 CATAAGCCTTAACCTGCCTAA pLKO.1 987 CDS 100% 4.050 2.835 N SLC36A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006714756.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05069 pDONR223 100% 93.1% 93.1% None 743_744ins99 n/a
2 ccsbBroad304_05069 pLX_304 0% 93.1% 93.1% V5 743_744ins99 n/a
3 TRCN0000480387 GGTATACCCAAATGAGTTGCACCT pLX_317 24.7% 93.1% 93.1% V5 743_744ins99 n/a
Download CSV