Construct: ORF TRCN0000480388
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000836.1_s317c1
- Derived from:
- ccsbBroadEn_12727
- DNA Barcode:
- AGACCCGATAATCGCCGGATCAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADAMTS12 (81792)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480388
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81792 | ADAMTS12 | ADAM metallopeptidase with ... | NM_001324511.2 | 98.7% | 98.7% | 688_696delTTGTTTTAT |
| 2 | human | 81792 | ADAMTS12 | ADAM metallopeptidase with ... | NM_001324512.2 | 14.6% | 14.2% | (many diffs) |
| 3 | human | 81792 | ADAMTS12 | ADAM metallopeptidase with ... | NM_030955.4 | 13.8% | 13.4% | (many diffs) |
| 4 | human | 81792 | ADAMTS12 | ADAM metallopeptidase with ... | XM_017009905.1 | 13.5% | 13.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 753
- ORF length:
- 687
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc atgtgcccag aggagctggc ttgcaaacct ttccgtggtg gctcagctcc 121 ttaactttgg ggcgctttgc tatgggagac agcctcagcc aggcccggtt cgcttcccgg 181 acaggaggca agagcatttt atcaagggcc tgccagaata ccacgtggtg ggtccagtcc 241 gagtagatgc cagtgggcat tttttgtcat atggcttgca ctatcccatc acgagcagca 301 ggaggaagag agatttggat ggctcagagg actgggtgta ctacagaatt tctcacgagg 361 agaaggacct gttttttaac ttgacggtca atcaaggatt tctttccaat agctacatca 421 tggagaagag atatgggaac ctctcccatg ttaagatgat ggcttccTCT GCCCCCCTCT 481 GCCATCTCAG TGGCACGGTT CTACAGCAGG GCACCAGAGT TGGGACGGCA GCCCTCAGTG 541 CCTGCCATGG ACTGACTGGA TTTTTCCAAC TACCACATGG AGACTTTTTC ATTGAACCCG 601 TGAAGAAGCA TCCACTGGTT GAGGGAGGGT ACCACCCGCA CATCGTTTAC AGGAGGCAGA 661 AAGTTCCAGA AACCAAGGAG CCAACCTGTG GATTAAAGGG TATTGTGACT CACATGTCCT 721 CCTGGGTTGA AGAATCTGTT TTGTTCTTTT GGTACCCAAC TTTCTTGTAC AAAGTGGTTG 781 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 841 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAG 901 ACCCGATAAT CGCCGGATCA ACACGCGTTA AGTCgacaat caacctctgg attacaaaat 961 ttgtgaaaga tt