Transcript: Human XM_017009905.1

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 12 (ADAMTS12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS12 (81792)
Length:
8873
CDS:
325..5220

Additional Resources:

NCBI RefSeq record:
XM_017009905.1
NBCI Gene record:
ADAMTS12 (81792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073868 CGGCTCATTCTACTCGAAGAA pLKO.1 1213 CDS 100% 4.950 6.930 N ADAMTS12 n/a
2 TRCN0000371175 GTACCACCCGCACATCGTTTA pLKO_005 888 CDS 100% 0.000 0.000 N ADAMTS12 n/a
3 TRCN0000371176 CAGTGGAACGGGAACTATAAG pLKO_005 2602 CDS 100% 13.200 10.560 N ADAMTS12 n/a
4 TRCN0000377652 TGAGCTCTCGCTATCTCATTT pLKO_005 3662 CDS 100% 13.200 9.240 N ADAMTS12 n/a
5 TRCN0000073869 CGCAGTTGTAACATCAATGAA pLKO.1 1444 CDS 100% 5.625 3.938 N ADAMTS12 n/a
6 TRCN0000073872 CCCGGAGTGATCTATGATGTT pLKO.1 1726 CDS 100% 4.950 3.465 N ADAMTS12 n/a
7 TRCN0000073870 CCCTGGCATCAAGTATGAGTA pLKO.1 2733 CDS 100% 4.950 3.465 N ADAMTS12 n/a
8 TRCN0000073871 CCTTGACCAAAGGTCCAGAAA pLKO.1 3872 CDS 100% 4.950 3.465 N ADAMTS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12727 pDONR223 100% 13.5% 13.1% None (many diffs) n/a
2 ccsbBroad304_12727 pLX_304 0% 13.5% 13.1% V5 (many diffs) n/a
3 TRCN0000480388 AGACCCGATAATCGCCGGATCAAC pLX_317 41.8% 13.5% 13.1% V5 (many diffs) n/a
4 ccsbBroadEn_16014 pDONR223 0% 13.5% 13.1% None (many diffs) n/a
5 ccsbBroad304_16014 pLX_304 0% 13.5% 13.1% V5 (many diffs) n/a
Download CSV