Construct: ORF TRCN0000480398
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014372.1_s317c1
- Derived from:
- ccsbBroadEn_10896
- DNA Barcode:
- CGGGCTGAATCCCCTGACTACATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ICA1 (3382)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480398
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001276478.2 | 100% | 100% | |
| 2 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350821.2 | 100% | 100% | |
| 3 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350823.2 | 100% | 100% | |
| 4 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350824.2 | 100% | 100% | |
| 5 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350825.2 | 100% | 100% | |
| 6 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001136020.3 | 99.7% | 99.7% | 17_19delGCA |
| 7 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350819.2 | 99.7% | 99.7% | 17_19delGCA |
| 8 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350820.2 | 99.7% | 99.7% | 17_19delGCA |
| 9 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_004968.3 | 99.7% | 99.7% | 17_19delGCA |
| 10 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_022307.3 | 99.7% | 99.7% | 17_19delGCA |
| 11 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350834.2 | 95.6% | 95.4% | 952_953ins63 |
| 12 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350831.2 | 95.4% | 95.2% | 17_19delGCA;955_956ins63 |
| 13 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350832.2 | 95.4% | 95.2% | 17_19delGCA;955_956ins63 |
| 14 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350833.2 | 95.4% | 95.2% | 17_19delGCA;955_956ins63 |
| 15 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350828.2 | 94.3% | 94.3% | 900_986del |
| 16 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350829.2 | 94.3% | 94.3% | 900_986del |
| 17 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515351.1 | 94.3% | 94.3% | 900_986del |
| 18 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515353.2 | 94.3% | 94.3% | 900_986del |
| 19 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_017012116.1 | 94.3% | 94.3% | 900_986del |
| 20 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_024446741.1 | 94.3% | 94.3% | 900_986del |
| 21 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350826.2 | 94.1% | 94.1% | 17_19delGCA;903_989del |
| 22 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350827.2 | 94.1% | 94.1% | 17_19delGCA;903_989del |
| 23 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515347.3 | 94.1% | 94.1% | 17_19delGCA;903_989del |
| 24 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515348.1 | 94.1% | 94.1% | 17_19delGCA;903_989del |
| 25 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515349.1 | 94.1% | 94.1% | 17_19delGCA;903_989del |
| 26 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350830.2 | 90.2% | 90% | 900_986del;1039_1040ins63 |
| 27 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_024446740.1 | 84.7% | 84.7% | 1_171del;188_190delGCA;1074_1160del |
| 28 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350838.2 | 84.2% | 84.2% | 17_19delGCA;576_577ins225 |
| 29 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350835.2 | 84.2% | 82.5% | (many diffs) |
| 30 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350836.2 | 84.2% | 82.5% | (many diffs) |
| 31 | human | 3382 | ICA1 | islet cell autoantigen 1 | NM_001350837.2 | 84.2% | 82.5% | (many diffs) |
| 32 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_017012125.1 | 84.2% | 82.5% | (many diffs) |
| 33 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515354.1 | 79.4% | 77.8% | (many diffs) |
| 34 | human | 3382 | ICA1 | islet cell autoantigen 1 | XR_002956426.1 | 76.2% | (many diffs) | |
| 35 | human | 3382 | ICA1 | islet cell autoantigen 1 | NR_146926.2 | 60.6% | 1_153del;1053_1094del;1642_2383del | |
| 36 | human | 3382 | ICA1 | islet cell autoantigen 1 | NR_146929.2 | 60.6% | (many diffs) | |
| 37 | human | 3382 | ICA1 | islet cell autoantigen 1 | NR_146928.2 | 59.1% | 1_153del;1479_1580del;1702_2443del | |
| 38 | human | 3382 | ICA1 | islet cell autoantigen 1 | NR_146927.2 | 58.9% | (many diffs) | |
| 39 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515355.3 | 53.6% | 53.6% | 0_1ins624;276_362del |
| 40 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515356.3 | 53.6% | 53.6% | 0_1ins624;276_362del |
| 41 | human | 3382 | ICA1 | islet cell autoantigen 1 | XM_011515357.2 | 49.9% | 48.5% | (many diffs) |
| 42 | human | 3382 | ICA1 | islet cell autoantigen 1 | XR_002956427.1 | 46% | (many diffs) | |
| 43 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | NM_010492.3 | 86.5% | 89.2% | (many diffs) |
| 44 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | XM_006504993.3 | 86.5% | 89.2% | (many diffs) |
| 45 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | XM_006504994.3 | 86.5% | 89.2% | (many diffs) |
| 46 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | NM_001252266.1 | 83% | 86.3% | (many diffs) |
| 47 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | XM_006504995.3 | 83% | 86.3% | (many diffs) |
| 48 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | XR_001785099.1 | 44.2% | (many diffs) | |
| 49 | mouse | 15893 | Ica1 | islet cell autoantigen 1 | XR_001785098.1 | 43% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1512
- ORF length:
- 1446
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ctggcatgtc aggacacaaa tgttatccct gggacttaca ggatcgatat gctcaagata 121 agtcagttgt aaataagatg caacagaaat attgggagac gaagcaggcc tttattaaag 181 ccacagggaa gaaggaagat gaacatgttg ttgcctctga cgcggacctg gatgccaagc 241 tagagctgtt tcattcaatt cagagaacct gtctggactt atcgaaagca attgtactct 301 atcaaaagag gatatgtttc ttgtctcaag aagaaaacga actgggaaaa tttcttcgat 361 cccaaggttt ccaagataaa accagagcag gaaagatgat gcaagcgaca ggaaaggccc 421 tctgcttttc ttcccagcaa aggttggcct tacgaaatcc tttgtgtcga tttcaccaag 481 aagtggagac ttttcggcat cgggccatct cagatacttg gctgacggtg aaccgcatgg 541 aacagtgcag gacggaatat agaggagcac tattatggat gaaggacgtg tctcaggagc 601 ttgatccaga cctctacaag caaatggaga agttcaggaa ggtacaaaca caagtgcgcc 661 ttgcaaaaaa aaactttgac aaattgaaga tggatgtttg tcaaaaagtg gatcttcttg 721 gagcgagcag atgcaatctc ttgtctcaca tgctagcaac ataccagacc actctgcttc 781 atttttggga gaaaacttct cacactatgg cagccatcca tgagagtttc aaaggttatc 841 aaccatatga atttactact ttaaagagct tacaagaccc tatgaaaaaa ttagttgaga 901 aagaagagaa gaagaaaatc aaccagcagg aaagtacaga tgcagccgtg caggagccga 961 gccaattaat ttcattagag gaagaaaacc agcgcaagga atcctctagt tttaagactg 1021 aagatggaaa aagtatttta tctgccttag acaaaggctc tacacatact gcatgctcag 1081 gacccataga tgaactatta gacatgaaaT CTGAGGAAGG TGCTTGCCTG GGACCAGTGG 1141 CAGGGACCCC GGAACCTGAA GGTGCTGACA AAGATGACCT GCTGCTGTTG AGTGAGATCT 1201 TCAATGCTTC CTCCTTGGAA GAGGGCGAGT TCAGCAAAGA GTGGGCCGCT GTGTTTGGAG 1261 ACGGCCAAGT GAAGGAGCCA GTGCCCACTA TGGCCCTGGG AGAGCCAGAC CCCAAGGCCC 1321 AGACAGGCTC AGGTTTCCTT CCTTCGCAGC TTTTAGACCA AAATATGAAA GACTTACAGG 1381 CCTCGCTACA AGAACCTGCT AAGGCTGCCT CAGACCTGAC TGCCTGGTTC AGCCTCTTCG 1441 CTGACCTCGA CCCACTCTCA AATCCTGATG CTGTTGGGAA AACCGATAAA GAACACGAAT 1501 TGCTCAATGC ATGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1561 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1621 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACGG GCTGAATCCC CTGACTACAT 1681 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t