Transcript: Human NR_146927.2

Homo sapiens islet cell autoantigen 1 (ICA1), transcript variant 25, non-coding RNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
ICA1 (3382)
Length:
2279
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146927.2
NBCI Gene record:
ICA1 (3382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285477 GCAGGAGCCGAGCCAATTAAT pLKO_005 1039 3UTR 100% 15.000 21.000 N ICA1 n/a
2 TRCN0000136437 CCTTTATTAAAGCCACAGGGA pLKO.1 260 3UTR 100% 0.660 0.924 N ICA1 n/a
3 TRCN0000134158 CGAATTGCTCAATGCATGAAT pLKO.1 1522 3UTR 100% 5.625 4.500 N ICA1 n/a
4 TRCN0000276054 CGAATTGCTCAATGCATGAAT pLKO_005 1522 3UTR 100% 5.625 4.500 N ICA1 n/a
5 TRCN0000135726 CAGGATCGATATGCTCAAGAT pLKO.1 190 3UTR 100% 4.950 3.960 N ICA1 n/a
6 TRCN0000276052 GAACAGTGCAGGACGGAATAT pLKO_005 631 3UTR 100% 13.200 9.240 N ICA1 n/a
7 TRCN0000276053 TATCTCTATGTGGATCTAAAT pLKO_005 1727 3UTR 100% 13.200 9.240 N ICA1 n/a
8 TRCN0000137189 GCCAAGCTAGAGCTGTTTCAT pLKO.1 325 3UTR 100% 5.625 3.938 N ICA1 n/a
9 TRCN0000134737 GCTAGAGCTGTTTCATTCAAT pLKO.1 330 3UTR 100% 5.625 3.938 N ICA1 n/a
10 TRCN0000276051 GCTAGAGCTGTTTCATTCAAT pLKO_005 330 3UTR 100% 5.625 3.938 N ICA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10896 pDONR223 100% 58.9% None (many diffs) n/a
2 ccsbBroad304_10896 pLX_304 0% 58.9% V5 (many diffs) n/a
3 TRCN0000480398 CGGGCTGAATCCCCTGACTACATT pLX_317 28.1% 58.9% V5 (many diffs) n/a
4 ccsbBroadEn_15459 pDONR223 0% 42% None (many diffs) n/a
5 ccsbBroad304_15459 pLX_304 0% 42% V5 (many diffs) n/a
6 TRCN0000491770 TGTTAGAGCCGTACTTCATGTAGC pLX_317 29.7% 40.2% V5 (many diffs) n/a
Download CSV