Transcript: Mouse XR_001785099.1

PREDICTED: Mus musculus islet cell autoantigen 1 (Ica1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ica1 (15893)
Length:
2846
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785099.1
NBCI Gene record:
Ica1 (15893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126987 GCCGAGGCAGTTAATTTCTTT pLKO.1 2211 3UTR 100% 5.625 3.938 N Ica1 n/a
2 TRCN0000126986 GTTGGCCTTGAGAAACCCTTT pLKO.1 918 3UTR 100% 4.050 2.835 N Ica1 n/a
3 TRCN0000126985 GCAGAAATATTGGGAGACCAA pLKO.1 618 3UTR 100% 2.640 1.848 N Ica1 n/a
4 TRCN0000134158 CGAATTGCTCAATGCATGAAT pLKO.1 2679 3UTR 100% 5.625 7.875 N ICA1 n/a
5 TRCN0000276054 CGAATTGCTCAATGCATGAAT pLKO_005 2679 3UTR 100% 5.625 7.875 N ICA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10896 pDONR223 100% 44.2% None (many diffs) n/a
2 ccsbBroad304_10896 pLX_304 0% 44.2% V5 (many diffs) n/a
3 TRCN0000480398 CGGGCTGAATCCCCTGACTACATT pLX_317 28.1% 44.2% V5 (many diffs) n/a
4 ccsbBroadEn_15459 pDONR223 0% 30% None (many diffs) n/a
5 ccsbBroad304_15459 pLX_304 0% 30% V5 (many diffs) n/a
6 TRCN0000491770 TGTTAGAGCCGTACTTCATGTAGC pLX_317 29.7% 30% V5 (many diffs) n/a
Download CSV