Construct: ORF TRCN0000480402
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012163.1_s317c1
- Derived from:
- ccsbBroadEn_01584
- DNA Barcode:
- ACCGATTTTATCTCGTCTTTTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPARC (6678)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480402
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6678 | SPARC | secreted protein acidic and... | NM_003118.4 | 100% | 100% | |
| 2 | human | 6678 | SPARC | secreted protein acidic and... | NM_001309443.2 | 99.6% | 99.6% | 57_58insCAG |
| 3 | human | 6678 | SPARC | secreted protein acidic and... | NM_001309444.2 | 88.4% | 86.5% | 883_884insAG;908_1023del |
| 4 | mouse | 20692 | Sparc | secreted acidic cysteine ri... | NM_001290817.1 | 89.3% | 92.4% | (many diffs) |
| 5 | mouse | 20692 | Sparc | secreted acidic cysteine ri... | NM_009242.5 | 89.2% | 92.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 975
- ORF length:
- 909
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ggcctggatc ttctttctcc tttgcctggc cgggagggcc ttggcagccc 121 ctcagcaaga agccctgcct gatgagacag aggtggtgga agaaactgtg gcagaggtga 181 ctgaggtatc tgtgggagct aatcctgtcc aggtggaagt aggagaattt gatgatggtg 241 cagaggaaac cgaagaggag gtggtggcgg aaaatccctg ccagaaccac cactgcaaac 301 acggcaaggt gtgcgagctg gatgagaaca acacccccat gtgcgtgtgc caggacccca 361 ccagctgccc agcccccatt ggcgagtttg agaaggtgtg cagcaatgac aacaagacct 421 tcgactcttc ctgccacttc tttgccacaa agtgcaccct ggagggcacc aagaagggcc 481 acaagctcca cctggactac atcgggcctt gcaaatacat ccccccttgc ctggactctg 541 agctgaccga attccccctg cgcatgcggg actggctcaa gaacgtcctg gTCACCCTGT 601 ATGAGAGGGA TGAGGACAAC AACCTTCTGA CTGAGAAGCA GAAGCTGCGG GTGAAGAAGA 661 TCCATGAGAA TGAGAAGCGC CTGGAGGCAG GAGACCACCC CGTGGAGCTG CTGGCCCGGG 721 ACTTCGAGAA GAACTATAAC ATGTACATCT TCCCTGTACA CTGGCAGTTC GGCCAGCTGG 781 ACCAGCACCC CATTGACGGG TACCTCTCCC ACACCGAGCT GGCTCCACTG CGTGCTCCCC 841 TCATCCCCAT GGAGCATTGC ACCACCCGCT TTTTCGAGAC CTGTGACCTG GACAATGACA 901 AGTACATCGC CCTGGATGAG TGGGCCGGCT GCTTCGGCAT CAAGCAGAAG GATATCGACA 961 AGGATCTTGT GATCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1021 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1081 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ACCGATTTTA TCTCGTCTTT 1141 TTTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt