Transcript: Mouse NM_009242.5

Mus musculus secreted acidic cysteine rich glycoprotein (Sparc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sparc (20692)
Length:
2641
CDS:
307..1215

Additional Resources:

NCBI RefSeq record:
NM_009242.5
NBCI Gene record:
Sparc (20692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009242.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418600 GAATACATTAACGGTGCTAAA pLKO_005 1346 3UTR 100% 10.800 15.120 N Sparc n/a
2 TRCN0000080352 CATCGGACCATGCAAATACAT pLKO.1 738 CDS 100% 5.625 7.875 N Sparc n/a
3 TRCN0000080350 GAAGGTATGCAGCAATGACAA pLKO.1 630 CDS 100% 4.950 3.960 N Sparc n/a
4 TRCN0000418454 ACAAGGATCTGGTGATCTAAG pLKO_005 1196 CDS 100% 10.800 7.560 N Sparc n/a
5 TRCN0000080349 CCTAGACAACGACAAGTACAT pLKO.1 1125 CDS 100% 4.950 3.465 N Sparc n/a
6 TRCN0000008712 GTGAAGAAGATCCATGAGAAT pLKO.1 889 CDS 100% 4.950 3.465 N SPARC n/a
7 TRCN0000437134 AGCACGAGGAGATATCTCTAG pLKO_005 1529 3UTR 100% 4.050 2.835 N Sparc n/a
8 TRCN0000080351 CCATCATTGCAAACATGGCAA pLKO.1 525 CDS 100% 2.640 1.848 N Sparc n/a
9 TRCN0000420278 ACTTTGAGAAGAACTACAATA pLKO_005 959 CDS 100% 13.200 7.920 N Sparc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009242.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01584 pDONR223 100% 89.2% 92.4% None (many diffs) n/a
2 ccsbBroad304_01584 pLX_304 0% 89.2% 92.4% V5 (many diffs) n/a
3 TRCN0000480402 ACCGATTTTATCTCGTCTTTTTTC pLX_317 42.4% 89.2% 92.4% V5 (many diffs) n/a
Download CSV