Transcript: Human NM_001309444.2

Homo sapiens secreted protein acidic and cysteine rich (SPARC), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SPARC (6678)
Length:
3449
CDS:
65..1090

Additional Resources:

NCBI RefSeq record:
NM_001309444.2
NBCI Gene record:
SPARC (6678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001309444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418600 GAATACATTAACGGTGCTAAA pLKO_005 1099 3UTR 100% 10.800 15.120 N Sparc n/a
2 TRCN0000008709 CGGTTGTTCTTTCCTCACATT pLKO.1 1850 3UTR 100% 4.950 6.930 N SPARC n/a
3 TRCN0000008710 CCTGGACAATGACAAGTACAT pLKO.1 886 CDS 100% 4.950 3.465 N SPARC n/a
4 TRCN0000008711 CCAGGTGGAAGTAGGAGAATT pLKO.1 208 CDS 100% 0.000 0.000 N SPARC n/a
5 TRCN0000008713 CTGCCACTTCTTTGCCACAAA pLKO.1 430 CDS 100% 4.950 2.970 N SPARC n/a
6 TRCN0000008712 GTGAAGAAGATCCATGAGAAT pLKO.1 650 CDS 100% 4.950 2.970 N SPARC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001309444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01584 pDONR223 100% 88.4% 86.5% None 883_884insAG;908_1023del n/a
2 ccsbBroad304_01584 pLX_304 0% 88.4% 86.5% V5 883_884insAG;908_1023del n/a
3 TRCN0000480402 ACCGATTTTATCTCGTCTTTTTTC pLX_317 42.4% 88.4% 86.5% V5 883_884insAG;908_1023del n/a
Download CSV