Construct: ORF TRCN0000480430
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000367.1_s317c1
- Derived from:
- ccsbBroadEn_06031
- DNA Barcode:
- ATTCGGAGAGACCCCCTCCGAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPM (1368)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480430
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1368 | CPM | carboxypeptidase M | NM_001005502.2 | 99.9% | 100% | 417T>C |
2 | human | 1368 | CPM | carboxypeptidase M | NM_001874.4 | 99.9% | 100% | 417T>C |
3 | human | 1368 | CPM | carboxypeptidase M | NM_198320.5 | 99.9% | 100% | 417T>C |
4 | human | 1368 | CPM | carboxypeptidase M | XR_001748580.2 | 68.1% | 1_24del;441T>C;1354_1949del | |
5 | human | 1368 | CPM | carboxypeptidase M | XR_001748577.2 | 67.8% | 1_33del;450T>C;1363_1958del | |
6 | human | 1368 | CPM | carboxypeptidase M | XR_001748579.2 | 67.3% | 1_46del;463T>C;1376_1971del | |
7 | human | 1368 | CPM | carboxypeptidase M | XR_001748578.2 | 67.1% | 1_33del;450T>C;1363_1977del | |
8 | human | 1368 | CPM | carboxypeptidase M | XR_001748582.2 | 62.8% | (many diffs) | |
9 | human | 1368 | CPM | carboxypeptidase M | XR_001748581.2 | 61.8% | (many diffs) | |
10 | human | 1368 | CPM | carboxypeptidase M | XR_001748583.2 | 53.3% | (many diffs) | |
11 | human | 1368 | CPM | carboxypeptidase M | XR_001748584.2 | 53% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1395
- ORF length:
- 1329
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cttcccgtgc ctctggctag ggctgttgct gcctttggta gctgcgctgg 121 atttcaacta ccaccgccag gaagggatgg aagcgttttt gaagactgtt gcccaaaact 181 acagttctgt cactcactta cacagtattg ggaaatctgt gaaaggtaga aacctgtggg 241 ttcttgttgt ggggcggttt ccaaaggaac acagaattgg gattccagag ttcaaatacg 301 tggcaaatat gcatggagat gagactgttg ggcgggagct gctgctccat ctgattgact 361 atctcgtaac cagtgatggc aaagaccctg aaatcacaaa tctgatcaat agtacccgga 421 tacacatcat gccttccatg aacccagatg gatttgaagc cgtcaaaaag cctgactgtt 481 actacagcat cggaagggaa aattataacc agtatgactt gaatcgaaat ttccccgatg 541 cttttgaata taataatgtc tcaaggcagc ctgaaactgt ggcagtcatg aagtggctga 601 aaacagagac gtttgtcctc tctgcaaacc tccatggtgg tgccctcgtg gccagttacc 661 catttgataa tggtgttcaa gcaactgggg cattatactc ccgaagctta acgcctgatg 721 atgatgtttt tcaatatctt gcacatacct atgcttcaag aaatcccaac atgaagaaag 781 gagacgagtg taaaaacaaa atgaactttc ctaatggtgt tacaaatgga tactcttggt 841 atccactcca aggtggaatg caagattaca actacatctg ggcccagtgt tttgaaatta 901 cgttggagct gtcatgctgt aaatatccTC GTGAGGAGAA GCTTCCATCC TTTTGGAATA 961 ATAACAAAGC CTCATTAATT GAATATATAA AGCAGGTGCA CCTAGGTGTA AAGGGTCAAG 1021 TTTTTGATCA GAATGGAAAT CCATTACCCA ATGTAATTGT GGAAGTCCAA GACAGAAAAC 1081 ATATCTGCCC CTATAGAACC AACAAATATG GAGAGTATTA TCTCCTTCTC TTGCCTGGGT 1141 CTTATATAAT AAATGTTACA GTCCCTGGAC ATGATCCACA CATCACAAAG GTGATTATTC 1201 CGGAGAAATC CCAGAACTTC AGTGCTCTTA AAAAGGATAT TCTACTTCCA TTCCAAGGGC 1261 AATTGGATTC TATCCCAGTA TCAAATCCTT CATGCCCAAT GATTCCTCTA TACAGAAATT 1321 TGCCAGACCA CTCAGCTGCA ACAAAGCCTA GTTTGTTCTT ATTTTTAGTG AGTCTTTTGC 1381 ACATATTCTT CAAATACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATTCGGAGAG ACCCCCTCCG 1561 AGGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt