Transcript: Human XR_001748577.2

PREDICTED: Homo sapiens carboxypeptidase M (CPM), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPM (1368)
Length:
1958
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748577.2
NBCI Gene record:
CPM (1368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050133 CCAGTATGACTTGAATCGAAA pLKO.1 477 3UTR 100% 4.950 6.930 N CPM n/a
2 TRCN0000288883 CCAGTATGACTTGAATCGAAA pLKO_005 477 3UTR 100% 4.950 6.930 N CPM n/a
3 TRCN0000050135 CCAACAAATATGGAGAGTATT pLKO.1 1067 3UTR 100% 13.200 9.240 N CPM n/a
4 TRCN0000288950 CCAACAAATATGGAGAGTATT pLKO_005 1067 3UTR 100% 13.200 9.240 N CPM n/a
5 TRCN0000050137 CCAGAACTTCAGTGCTCTTAA pLKO.1 1179 3UTR 100% 13.200 9.240 N CPM n/a
6 TRCN0000288951 CCAGAACTTCAGTGCTCTTAA pLKO_005 1179 3UTR 100% 13.200 9.240 N CPM n/a
7 TRCN0000050134 CCATTTGATAATGGTGTTCAA pLKO.1 628 3UTR 100% 0.495 0.347 N CPM n/a
8 TRCN0000050136 CCCTGAAATCACAAATCTGAT pLKO.1 354 3UTR 100% 4.950 2.970 N CPM n/a
9 TRCN0000288948 CCCTGAAATCACAAATCTGAT pLKO_005 354 3UTR 100% 4.950 2.970 N CPM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06031 pDONR223 100% 67.8% None 1_33del;450T>C;1363_1958del n/a
2 ccsbBroad304_06031 pLX_304 0% 67.8% V5 1_33del;450T>C;1363_1958del n/a
3 TRCN0000480430 ATTCGGAGAGACCCCCTCCGAGGT pLX_317 35.3% 67.8% V5 1_33del;450T>C;1363_1958del n/a
Download CSV