Construct: ORF TRCN0000480478
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005295.1_s317c1
- Derived from:
- ccsbBroadEn_01469
- DNA Barcode:
- ATAACCCTTGACATTTCACTACGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RSU1 (6251)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480478
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6251 | RSU1 | Ras suppressor protein 1 | NM_012425.4 | 100% | 100% | |
| 2 | human | 6251 | RSU1 | Ras suppressor protein 1 | NM_152724.2 | 80.8% | 80.8% | 0_1ins159 |
| 3 | human | 6251 | RSU1 | Ras suppressor protein 1 | XM_005252552.4 | 72.4% | 68.1% | 598_599ins133;699_831del |
| 4 | mouse | 20163 | Rsu1 | Ras suppressor protein 1 | NM_009105.4 | 88.5% | 97.1% | (many diffs) |
| 5 | mouse | 20163 | Rsu1 | Ras suppressor protein 1 | XM_006497405.3 | 83.5% | 91.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 897
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc caagtctctg aagaagttgg tggaggagag ccgggagaag aaccagcccg 121 aggtggacat gagtgaccgg ggcatctcca acatgctgga tgtcaacggc ctctttacct 181 tatcccatat cacacaactg gtcctcagcc ataacaagct aacaatggtg ccaccgaaca 241 tcgcagaact gaagaatttg gaggtgctca acttttttaa taaccaaatc gaggagctgc 301 ccacacagat cagtagcctt cagaaactca aacacctgaa ccttggcatg aacaggctga 361 acactttgcc acgaggcttc ggctccctgc cagctcttga ggttctggac ttgacgtaca 421 acaacttgag cgaaaattct cttcctggaa acttcttcta cctgaccacc ctgcgtgcac 481 tctatctaag tgacaacgat tttgaaatcc tgccgccaga tattgggaag ctcacaaagt 541 tgcagatacT CAGCCTTAGG GATAACGACC TGATCTCGCT GCCTAAGGAA ATCGGGGAGC 601 TTACCCAGCT TAAAGAGCTC CACATTCAGG GGAACCGCCT CACCGTTCTG CCCCCAGAAC 661 TAGGAAACTT GGATTTAACT GGCCAGAAGC AGGTATTCAA AGCAGAGAAC AATCCCTGGG 721 TGACCCCCAT TGCAGACCAG TTCCAGCTTG GCGTGTCCCA TGTTTTTGAG TATATCCGTT 781 CTGAGACATA CAAATACCTC TACGGCAGAC ACATGCAGGC CAACCCAGAA CCACCGAAGA 841 AGAATAATGA CAAATCGAAA AAGATCAGCC GGAAACCCCT GGCAGCCAAG AACAGATACC 901 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 961 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1021 ATATATCTTG TGGAAAGGAC GAATAACCCT TGACATTTCA CTACGCACGC GTTAAGTCga 1081 caatcaacct ctggattaca aaatttgtga aagatt