Transcript: Mouse XM_006497405.3

PREDICTED: Mus musculus Ras suppressor protein 1 (Rsu1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rsu1 (20163)
Length:
1541
CDS:
221..1003

Additional Resources:

NCBI RefSeq record:
XM_006497405.3
NBCI Gene record:
Rsu1 (20163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497405.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256463 CTATCTAAGCGACAACGATTT pLKO_005 586 CDS 100% 10.800 15.120 N Rsu1 n/a
2 TRCN0000256465 GCTTGGCAACTTGGATCTAAC pLKO_005 763 CDS 100% 10.800 8.640 N Rsu1 n/a
3 TRCN0000077627 CCTTGGCATGAATAGGTTGAA pLKO.1 445 CDS 100% 4.950 3.960 N Rsu1 n/a
4 TRCN0000256466 ACGTCACAAGGCTGCTTATTA pLKO_005 1308 3UTR 100% 15.000 10.500 N Rsu1 n/a
5 TRCN0000265802 GAAGAACTTGGAGGTACTAAA pLKO_005 355 CDS 100% 13.200 9.240 N Rsu1 n/a
6 TRCN0000256464 GATATTGGGAAGCTCACAAAG pLKO_005 623 CDS 100% 10.800 7.560 N Rsu1 n/a
7 TRCN0000077624 CCAAAGAAGAATAACGACAAA pLKO.1 938 CDS 100% 4.950 3.465 N Rsu1 n/a
8 TRCN0000077626 GCAGGTCTTCAAAGCAGAGAA pLKO.1 793 CDS 100% 4.950 3.465 N Rsu1 n/a
9 TRCN0000077625 CCTCAGGGATAATGACCTGAT pLKO.1 658 CDS 100% 0.405 0.284 N Rsu1 n/a
10 TRCN0000077623 GCTCTCATTCTCCTGCAAATT pLKO.1 1253 3UTR 100% 13.200 7.920 N Rsu1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497405.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01469 pDONR223 100% 83.5% 91.6% None (many diffs) n/a
2 ccsbBroad304_01469 pLX_304 0% 83.5% 91.6% V5 (many diffs) n/a
3 TRCN0000480478 ATAACCCTTGACATTTCACTACGC pLX_317 42% 83.5% 91.6% V5 (many diffs) n/a
Download CSV