Construct: ORF TRCN0000480483
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002556.1_s317c1
- Derived from:
- ccsbBroadEn_14620
- DNA Barcode:
- GCAGGCATTAACTTTTAGGCATCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- DUT (1854)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480483
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1854 | DUT | deoxyuridine triphosphatase | NM_001025248.2 | 98% | 13.7% | (many diffs) |
2 | human | 1854 | DUT | deoxyuridine triphosphatase | XM_017021988.1 | 74.4% | 17.3% | (many diffs) |
3 | human | 1854 | DUT | deoxyuridine triphosphatase | NM_001330286.2 | 63.9% | 7.2% | (many diffs) |
4 | human | 1854 | DUT | deoxyuridine triphosphatase | NM_001948.4 | 62.9% | 2.3% | (many diffs) |
5 | human | 1854 | DUT | deoxyuridine triphosphatase | NM_001025249.1 | 54.6% | 3.8% | (many diffs) |
6 | human | 1854 | DUT | deoxyuridine triphosphatase | XR_931760.1 | 53.9% | (many diffs) | |
7 | human | 1854 | DUT | deoxyuridine triphosphatase | XR_001751125.2 | 27.8% | (many diffs) | |
8 | human | 147658 | ZNF534 | zinc finger protein 534 | NM_001291369.3 | 18.3% | 12% | (many diffs) |
9 | human | 147658 | ZNF534 | zinc finger protein 534 | NM_001291368.3 | 16.2% | 9.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 255
- ORF length:
- 186
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gactcccctc tgccctcgcc ccgcgctctg ctaccatttc cttacgtctc 121 tgcttcgctc agcgatgcaa aacgcgcgag gcgagggcag aggggcgaag ccgcggtact 181 ctccgggcca ggcccgcccc tcggccgcgc cgcgcagcac gggattcccc ggccgctgtc 241 cagcgctggc cgcctgagcc aaggctgccg cggagccagt acagtcgggg ccgctggctg 301 gaagggcgag cttcctaagg cggggggaag cccggcgccg gggccggaga cacccgccat 361 ttcacccagt aagcgggccc ggcctgcgga ggtgggcggc atgcagctcc gcttTCCTCG 421 GCACCTCCGG ACGTGCGCCA GGCTTCCACC CGGGGCTCCG CGCGCGCCGC GGGCTACGAC 481 CTGTACAGTG CCTATGATTA CACAATACCA CCTATGGAGA AAGCTGTTGT GAAAACGGAC 541 ATTCAGATAG CGCTCCCTTC TGGGTGTTAT GGAAGAGTGG CTCCACGGTC AGGCTTGGCT 601 GCAAAACACT TTATTGATGT AGGAGCTGGT GTCATAGATG AAGATTATAG AGGAAATGTT 661 GGTGTTGTAC TGTTTAATTT TGGCAAAGAA AAGTTTGAAG TCAAAAAAGG TGATCGAATT 721 GCACAGCTCA TTTGCGAACG GATTTTTTAT CCAGAAATAG AAGAAGTTCA AGCCTTGGAT 781 GACACCGAAA GGGGTTCAGG AGGTTTTGGT TCCACTGGAA AGAATTTGCC AACTTTCTTG 841 TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG 901 TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT 961 GGAAAGGACG AGCAGGCATT AACTTTTAGG CATCCACGCG TTAAGTCgac aatcaacctc 1021 tggattacaa aatttgtgaa agatt