Transcript: Human NM_001948.4

Homo sapiens deoxyuridine triphosphatase (DUT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DUT (1854)
Length:
1845
CDS:
56..550

Additional Resources:

NCBI RefSeq record:
NM_001948.4
NBCI Gene record:
DUT (1854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050876 TGGTTCCACTGGAAAGAATTA pLKO.1 529 CDS 100% 13.200 18.480 N DUT n/a
2 TRCN0000416300 TCCGCAATTGAAGGTTGTATG pLKO_005 776 3UTR 100% 10.800 15.120 N DUT n/a
3 TRCN0000050873 AGTGCCTATGATTACACAATA pLKO.1 209 CDS 100% 13.200 9.240 N DUT n/a
4 TRCN0000050877 GCTGGTGTCATAGATGAAGAT pLKO.1 347 CDS 100% 4.950 3.465 N DUT n/a
5 TRCN0000050875 GCGCTCCCTTCTGGGTGTTAT pLKO.1 272 CDS 100% 4.400 3.080 N DUT n/a
6 TRCN0000425862 ACGGTCAGGCTTGGCTGCAAA pLKO_005 307 CDS 100% 1.650 1.155 N DUT n/a
7 TRCN0000431363 CCTTGGATGACACCGAAAGGG pLKO_005 495 CDS 100% 0.880 0.616 N DUT n/a
8 TRCN0000412391 GTTGGTGTTGTACTGTTTAAT pLKO_005 380 CDS 100% 15.000 9.000 N DUT n/a
9 TRCN0000050874 CCAGAAATAGAAGAAGTTCAA pLKO.1 473 CDS 100% 4.950 2.475 Y DUT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00469 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00469 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474179 GGTTCTGTGACTTCCATAACCATG pLX_317 87.6% 100% 100% V5 n/a
4 ccsbBroadEn_14620 pDONR223 65.2% 63.9% 2.3% None (many diffs) n/a
5 ccsbBroad304_14620 pLX_304 0% 63.9% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000480483 GCAGGCATTAACTTTTAGGCATCC pLX_317 54.1% 62.9% 2.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV