Transcript: Human NM_001291368.3

Homo sapiens zinc finger protein 534 (ZNF534), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF534 (147658)
Length:
1558
CDS:
165..746

Additional Resources:

NCBI RefSeq record:
NM_001291368.3
NBCI Gene record:
ZNF534 (147658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164103 CAGGGACGTGATGTTAGAGAA pLKO.1 263 CDS 100% 4.950 2.970 N ZNF534 n/a
2 TRCN0000164264 CTGCTACCATTTCCTTCCGTT pLKO.1 564 CDS 100% 2.640 1.584 N ZNF534 n/a
3 TRCN0000159017 GATGTTAGAGAACTACAGGAA pLKO.1 272 CDS 100% 2.640 1.584 N ZNF534 n/a
4 TRCN0000161881 GCAGAAAGCTTTATACAGGGA pLKO.1 248 CDS 100% 0.660 0.396 N ZNF534 n/a
5 TRCN0000050874 CCAGAAATAGAAGAAGTTCAA pLKO.1 1115 3UTR 100% 4.950 2.475 Y DUT n/a
6 TRCN0000162896 GAATCTGTCTTCCTGACCTGA pLKO.1 307 CDS 100% 2.640 1.320 Y ZNF534 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14620 pDONR223 65.2% 16.2% 9.5% None (many diffs) n/a
2 ccsbBroad304_14620 pLX_304 0% 16.2% 9.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480483 GCAGGCATTAACTTTTAGGCATCC pLX_317 54.1% 16.2% 9.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV