Construct: ORF TRCN0000480546
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000915.1_s317c1
- Derived from:
- ccsbBroadEn_06603
- DNA Barcode:
- CATAATTTAAATACTTACTCAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MUC1 (4582)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480546
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001018017.3 | 99.8% | 100% | 66G>A |
2 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001018016.3 | 96.4% | 96.5% | 55_81del;93G>A |
3 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_002456.6 | 93.2% | 93.4% | 66G>A;160_213del |
4 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204287.2 | 90.3% | 90.4% | 55_81del;93G>A;187_240del |
5 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204294.2 | 90% | 85.4% | 66G>A;159_160insTTTAATTCCTCTCTGGAAG;208_209ins56 |
6 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204291.1 | 87.7% | 87.8% | 55_81del;93G>A;186_187ins69 |
7 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204292.1 | 86.9% | 82.5% | (many diffs) |
8 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204289.2 | 86.6% | 86.7% | 55_81del;93G>A;186_187ins78 |
9 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204290.2 | 85% | 85% | 55_56ins36;123_124ins78 |
10 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044390.3 | 79.4% | 68.2% | 66G>A;159_160insTTTAATTCCTCTCTGGAAG;264_265ins137 |
11 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204288.2 | 79.4% | 56.6% | (many diffs) |
12 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204296.2 | 76.7% | 65.9% | (many diffs) |
13 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204295.1 | 68% | 68.1% | 55_81del;93G>A;254_255ins225 |
14 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204293.2 | 65.8% | 50.5% | (many diffs) |
15 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044393.3 | 61.8% | 26.7% | (many diffs) |
16 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044391.3 | 58.6% | 58.8% | 66G>A;226_227ins315 |
17 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001044392.3 | 56.6% | 56.8% | 55_81del;93G>A;253_254ins315 |
18 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204285.2 | 53.6% | 53.6% | 66G>A;160_819del |
19 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204297.2 | 53% | 53.1% | (many diffs) |
20 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001204286.1 | 52.6% | 52.6% | 55_81del;93G>A;187_846del |
21 | human | 4582 | MUC1 | mucin 1, cell surface assoc... | NM_001371720.1 | 19.4% | 17.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 834
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacaccgggc acccagtctc ctttcttcct gctgctgctc ctcacagtgc 121 ttacagttgt tacaggttct ggtcatgcaa gctctacccc aggtggagaa aaggagactt 181 cggctaccca gagaagttca gtgcccagct ctactgagaa gaatgctttt aattcctctc 241 tggaagatcc cagcaccgac tactaccaag agctgcagag agacatttct gaaatgtttt 301 tgcagattta taaacaaggg ggttttctgg gcctctccaa tattaagttc aggccaggat 361 ctgtggtggt acaattgact ctggccttcc gagaaggtac catcaatgtc cacgacgtgg 421 agacacagtt caatcagtat aaaacggaag cagcctctcg atataacctg acgatcTCAG 481 ACGTCAGCGT GAGTGATGTG CCATTTCCTT TCTCTGCCCA GTCTGGGGCT GGGGTGCCAG 541 GCTGGGGCAT CGCGCTGCTG GTGCTGGTCT GTGTTCTGGT TGCGCTGGCC ATTGTCTATC 601 TCATTGCCTT GGCTGTCTGT CAGTGCCGCC GAAAGAACTA CGGGCAGCTG GACATCTTTC 661 CAGCCCGGGA TACCTACCAT CCTATGAGCG AGTACCCCAC CTACCACACC CATGGGCGCT 721 ATGTGCCCCC TAGCAGTACC GATCGTAGCC CCTATGAGAA GGTTTCTGCA GGTAATGGTG 781 GCAGCAGCCT CTCTTACACA AACCCAGCAG TGGCAGCCAC TTCTGCCAAC TTGTTGCCAA 841 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 901 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 961 TATCTTGTGG AAAGGACGAC ATAATTTAAA TACTTACTCA GTTACGCGTT AAGTCgacaa 1021 tcaacctctg gattacaaaa tttgtgaaag att