Construct: ORF TRCN0000480630
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013180.1_s317c1
- Derived from:
- ccsbBroadEn_12131
- DNA Barcode:
- ACAGAGATGTCACGTATCACGGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMCO3 (55002)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480630
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537507.2 | 99% | 98.7% | 1226_1227insCAACAGA;1229_1231delTTTinsAGC;1233_1234insTC |
| 2 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_017020636.1 | 96.3% | 95.5% | (many diffs) |
| 3 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537504.2 | 90.5% | 89.9% | (many diffs) |
| 4 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537506.2 | 86.7% | 83.1% | (many diffs) |
| 5 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537509.2 | 84% | 83.8% | 1039_1043delAAACAinsGT;1050_1053delCCAGinsGATT;1056_1057ins189 |
| 6 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349741.2 | 78.9% | 78.4% | (many diffs) |
| 7 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_024449370.1 | 76.5% | 75.9% | (many diffs) |
| 8 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537502.3 | 76.1% | 75.6% | (many diffs) |
| 9 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_017020634.2 | 74.1% | 67.4% | (many diffs) |
| 10 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537501.2 | 74% | 73.5% | (many diffs) |
| 11 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349746.2 | 67.6% | 60.3% | (many diffs) |
| 12 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349744.2 | 63.1% | 62.7% | (many diffs) |
| 13 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_017020630.1 | 62.8% | 56.9% | (many diffs) |
| 14 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_017905.6 | 61.1% | 60.7% | (many diffs) |
| 15 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_006719969.1 | 61.1% | 60.7% | (many diffs) |
| 16 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XM_011537498.2 | 61.1% | 60.7% | (many diffs) |
| 17 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349743.2 | 56.7% | 49.6% | (many diffs) |
| 18 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349745.2 | 53.3% | 52.9% | (many diffs) |
| 19 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NM_001349742.2 | 51.6% | 51.2% | (many diffs) |
| 20 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XR_944279.3 | 49.6% | (many diffs) | |
| 21 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NR_146221.2 | 44.6% | (many diffs) | |
| 22 | human | 55002 | TMCO3 | transmembrane and coiled-co... | NR_146222.2 | 43.3% | (many diffs) | |
| 23 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XR_002957454.1 | 39.9% | (many diffs) | |
| 24 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XR_001749587.2 | 39.2% | (many diffs) | |
| 25 | human | 55002 | TMCO3 | transmembrane and coiled-co... | XR_001749590.2 | 37.7% | (many diffs) | |
| 26 | mouse | 234076 | Tmco3 | transmembrane and coiled-co... | XM_006508762.2 | 50.7% | 53.9% | (many diffs) |
| 27 | mouse | 234076 | Tmco3 | transmembrane and coiled-co... | NM_172282.2 | 50.6% | 53.6% | (many diffs) |
| 28 | mouse | 234076 | Tmco3 | transmembrane and coiled-co... | XM_006508763.1 | 46.5% | 49.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1308
- ORF length:
- 1242
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ggtgttggga agaagcttct tctgggtgct gtttcccgtc cttccctggg 121 cggtgcaggc tgtggagcac gaggaggtgg cgcagcgtgt gatcaaactg caccgcgggc 181 gaggggtggc tgccatgcag agccggcagt gggtccggga cagctgcagg aagctctcag 241 ggcttctccg ccagaagaat gcagttctga acaaactgaa aactgcaatt ggagcagtgg 301 agaaagacgt gggcctgtcg gatgaagaga aactgtttca ggtgcacacg tttgaaattt 361 tccagaaaga gctgaatgaa agtgaaaatt ccgttttcca agctgtctac ggactgcaga 421 gagccctgca gggggattac aaagatgtcg tgaacatgaa ggagagcagc cggcagcgcc 481 tggaggccct gagagaggct gcaataaagg aagaaacaga atatatggaa cttctggcag 541 cagaaaaaca tcaagttgaa gcccttaaaa atatgcaaca tcaaaaccaa agtttatcca 601 tgcttgacga gattcttgaa gatgtaagaa aggcagcgga tcgtctggag gaagagatag 661 aggaacatgc ttttgacgac aataaatcag tcaagggggt caattttgag gcagttctga 721 gggtggagga agaagaggcc aattctaagc aaaatataac aaaacgagaa gtggaggatg 781 acttgggtct tagcatgctg attgactccc agaacaacca gtatattttg accaagccca 841 gagattcaac catcccacgt gcagatcacc actttataaa ggacattgtt accataggaa 901 tgctgtcctt gccttgtggc tggctatgta cagccatagg attgccTACA ATGTTTGGTT 961 ATATTATTTG TGGTGTACTT CTGGGACCTT CAGGACTAAA TAGTATTAAG TCTATTGTGC 1021 AAGTGGAGAC ATTAGGAGAA TTTGGGGTGT TTTTTACTCT TTTTCTTGTT GGCTTAGAAT 1081 TTTCTCCAGA AAAGCTAAGA AAGGTGTGGA AGATTTCCTT ACAAGGGCCG TGTTACATGA 1141 CACTGTTAAT GATTGCATTT GGCTTGCTGT GGGGGCATCT CTTGCGGATC AAACCCACGC 1201 AGAGCGTCTT CATTTCCACG TGTCTGTCCT TGTCAAGCAC ACCCCTCGTG TCCAGGTTCC 1261 TCATGGGCAG TGCTCGGGGT GACAAAGAAG GCAACAGAAC AGCCCTCTAC CCAACTTTCT 1321 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1381 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1441 GTGGAAAGGA CGAACAGAGA TGTCACGTAT CACGGAAACG CGTTAAGTCg acaatcaacc 1501 tctggattac aaaatttgtg aaagatt