Transcript: Mouse NM_172282.2

Mus musculus transmembrane and coiled-coil domains 3 (Tmco3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tmco3 (234076)
Length:
4533
CDS:
447..2483

Additional Resources:

NCBI RefSeq record:
NM_172282.2
NBCI Gene record:
Tmco3 (234076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192703 GCCTACGATGTTTGGGTATAT pLKO.1 1325 CDS 100% 13.200 18.480 N Tmco3 n/a
2 TRCN0000314452 GCCTACGATGTTTGGGTATAT pLKO_005 1325 CDS 100% 13.200 18.480 N Tmco3 n/a
3 TRCN0000200883 GACGACAATAAATCAGTCAAA pLKO.1 1056 CDS 100% 4.950 6.930 N Tmco3 n/a
4 TRCN0000192232 CGTATCTCATAGGACCGTATT pLKO.1 1885 CDS 100% 10.800 8.640 N Tmco3 n/a
5 TRCN0000314390 CGTATCTCATAGGACCGTATT pLKO_005 1885 CDS 100% 10.800 8.640 N Tmco3 n/a
6 TRCN0000192772 CCTCATGCTTGCTTGCTATTT pLKO.1 2612 3UTR 100% 13.200 9.240 N Tmco3 n/a
7 TRCN0000314391 CCTCATGCTTGCTTGCTATTT pLKO_005 2612 3UTR 100% 13.200 9.240 N Tmco3 n/a
8 TRCN0000201140 CTTCCCTTCTTTCACCTGATA pLKO.1 483 CDS 100% 4.950 3.465 N Tmco3 n/a
9 TRCN0000191348 CCAGAGTAATTTATTTGCAGT pLKO.1 2664 3UTR 100% 2.640 1.848 N Tmco3 n/a
10 TRCN0000314392 CCAGAGTAATTTATTTGCAGT pLKO_005 2664 3UTR 100% 2.640 1.848 N Tmco3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08447 pDONR223 100% 83.1% 89.2% None (many diffs) n/a
2 ccsbBroad304_08447 pLX_304 0% 83.1% 89.2% V5 (many diffs) n/a
3 TRCN0000491571 CTGATCTCAAAAAGCTGTAGGTAG pLX_317 12.8% 83.1% 89.2% V5 (many diffs) n/a
4 ccsbBroadEn_12131 pDONR223 100% 50.6% 53.6% None (many diffs) n/a
5 ccsbBroad304_12131 pLX_304 0% 50.6% 53.6% V5 (many diffs) n/a
6 TRCN0000480630 ACAGAGATGTCACGTATCACGGAA pLX_317 29.4% 50.6% 53.6% V5 (many diffs) n/a
Download CSV