Construct: ORF TRCN0000480643
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006772.1_s317c1
- Derived from:
- ccsbBroadEn_10933
- DNA Barcode:
- CTGGCTGCAGCAATGCAAGATCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNG1 (3755)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480643
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3755 | KCNG1 | potassium voltage-gated cha... | NM_002237.4 | 51.6% | 49.8% | (many diffs) |
2 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_006723785.3 | 51.6% | 49.8% | (many diffs) |
3 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528800.2 | 51.6% | 49.8% | (many diffs) |
4 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528801.2 | 51.6% | 49.8% | (many diffs) |
5 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528802.2 | 51.6% | 49.8% | (many diffs) |
6 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528803.2 | 51.6% | 49.8% | (many diffs) |
7 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528804.1 | 51.6% | 49.8% | (many diffs) |
8 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528805.2 | 51.6% | 49.8% | (many diffs) |
9 | human | 3755 | KCNG1 | potassium voltage-gated cha... | XM_011528806.2 | 51.6% | 49.8% | (many diffs) |
10 | mouse | 241794 | Kcng1 | potassium voltage-gated cha... | NM_001081134.1 | 44.8% | 44.2% | (many diffs) |
11 | mouse | 241794 | Kcng1 | potassium voltage-gated cha... | XM_006499538.3 | 44.8% | 44.2% | (many diffs) |
12 | mouse | 241794 | Kcng1 | potassium voltage-gated cha... | XM_006499539.3 | 44.8% | 44.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cctcttaccg ggagacaatt ctgactacga ctacagcgcg ctgagctgca 121 cctcggacgc ctccttccac ccggccttcc tcccgcagcg ccaggccatc aagggcgcgt 181 tctaccgccg ggcgcagcgg ctgcggccgc aggatgagcc ccgccagggc tgtcagcccg 241 aggaccgccg ccgtcggatc atcatcaacg taggcggcat caagtactcg ctgccctgga 301 ccacgctgga cgagttcccg ctgacgcgcc tgggccagct caaggcctgc accaacttcg 361 acgacatcct caacgtgtgc gatgactacg acgtcacctg caacgagttc ttcttcgacc 421 gcaacccggg ggccttcggc actatcctga ccttccTGCG CGCGGGCAAG CTGCGGCTGC 481 TGCGCGAGAT GTGCGCGCTG TCCTTCCAGG AGGAGCTGCT GTACTGGGGC ATCGCGGAGG 541 ACCACCTGGA CGGCTGCTGC AAGCGCCGCT ACCTGCAGAA GATTGAGGAG TTCGCGGAGA 601 TGGTGGAGCG GGAGGAAGAG GACGACGCGC TGGACAGCGA GGGCCGCGAC AGCGAGGGCC 661 CGGCCGAGGG CGAGGGCCGC CTGGGGCGCT GCATGCGGCG ACTGCGCGAC ATGGTGGAGA 721 GGCCGCACTC GGGGCTGCCT GGCAAGGTGT TCGCCTGCCT GTCGGTGCTC TTCGTGACCG 781 TCACCGCCGT CAACCTCTCC GTCAGCACCT TGCCCAGCCT GAGGGAGGAG GAGGAGCAGG 841 TAAGAGCCCA CGCCCCGCGG GGAAACGCGC CACCACGAGG GAAGGGACTC TGCCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGACTGG CTGCAGCAAT GCAAGATCGT ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt